Check patentability & draft patents in minutes with Patsnap Eureka AI!

Bacillus thuringiensis strain and application thereof

A technology of Bacillus aureus and thuringiensis, which is applied to new Bt protein and its encoding gene and application fields, to achieve the effects of reducing environmental pollution, improving insecticidal activity and reducing the amount of use

Active Publication Date: 2013-08-28
SICHUAN AGRI UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

After 28 generations of Culex pentapipes were selected by the crystal protein of the Israeli subspecies (containing Cyt1Aa protein), the resistance was only increased by 3 times; but if the crystal protein without Cyt1Aa was used, the resistance would be increased by 90-900 times

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bacillus thuringiensis strain and application thereof
  • Bacillus thuringiensis strain and application thereof
  • Bacillus thuringiensis strain and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1c

[0031] Cloning of embodiment 1 cyt3Aa1 gene

[0032] The new bacterial strain TD516 of Bacillus thuringiensis isolated from the soil in the virgin forest area of ​​Muchuan, Sichuan Province in the present invention has been collected in the General Microorganism Center of China Microbiological Culture Collection Management Committee (Address: Chaoyang District, Beijing) on ​​January 12, 2009. Datun Road, Institute of Microbiology, Chinese Academy of Sciences, Zip code 100101) is preserved, the classification is named Bacillus thuringiensis (Bacillus thuringiensis), and the preservation number is CGMCC No.2859.

[0033] The full-length sequence of the cyt3Aa1 gene was obtained by cloning as follows.

[0034] The total DNA of strain TD516 was extracted using a genomic DNA purification kit (purchased from Saibaisheng Company). And design the primer sequence as follows:

[0035] P1: 5'ATGTATACTAAAAATTTTAGTAAG3'

[0036] P2: 5'TTACGAAAACTTTAAAATTATGAAT3'

[0037] 25μl PCR react...

Embodiment 2

[0047] Example 2 Obtaining of Cyt3Aa1 protein

[0048] According to the sequence of both ends of the open reading frame of Cyt3Aa1 gene, design and synthesize a pair of specific primers: cry3F:5'-CGG GGTACC ATGTATACTAAAAAATTTTAGTAAG-3cry3R:5'-CGC GTC GAC TTACGAAAACTTTTAAATTATGAAT-3', 5' end primers underlined bases are Kpn I and Sal I restriction sites respectively. Using TD516 plasmid DNA as a template for amplification, the amplified product was double-digested with Kpn I and Sal I, and the digested product was ligated with the vector pET-32a(+) after the same double-digestion, and transformed into E.coli DH5α For competent cells, the recombinant plasmid was named pET-3Aa. After restriction restriction electrophoresis of the recombinant plasmid verified that the size of the inserted fragment conformed to the target fragment ( figure 2 ) into the recipient strain E.coli.BL21(DE3), and the recombinant containing the recombinant plasmid was named E.coli.BL21(3Aa). Then t...

Embodiment 3

[0049] Anti-insect effect of embodiment 3Cyt3Aa1 protein

[0050] The Cyt3Aa1 protein obtained in Example 2 was used to measure the insecticidal activity against cotton bollworm, black beetle, North China black beetle and Aedes mosquito respectively.

[0051] For Lepidoptera pests: the Cyt3Aa1 protein obtained in Example 2 was formulated into 6 different concentrations from 1 μg / ml to 100ng / ml, and the old and tender cabbage leaves were selected to be washed and dried; Cut into 2×2cm 2 Soak in different concentrations of Cyt3Aa1 protein solution for 5 minutes; take out and drain the excess liquid, put it in a sterilized petri dish to dry, use the leaves soaked in LB liquid medium as a control, put 4 leaves in each petri dish 30 healthy 2-3 instar cotton bollworms were selected for each petri dish; each treatment was repeated 3 times, put indoors, observed the death of larvae after 3 days, and calculated LC with SPSS10.0 software 50 .

[0052] For Coleopteran pests: the Cyt3...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention provides a bacillus thuringiensis strain TD516 with an accession number of CGMCC No.2859. The strain has activity in inhibiting dipterans. The invention further provides application of the strain TD516 in preparation of a pesticide. The pesticide containing the strain TD516 can decrease the usage amount of a chemical insecticide and reduce environmental pollution and has critical economic values and application prospects.

Description

[0001] This application is a divisional application of a patent application with an application date of November 29, 2011, an application number of 201110387753.9, and an invention titled "A Bt protein Cyt3Aa1, its coding gene and its application". technical field [0002] The invention relates to the field of biotechnology, in particular to a novel Bt protein and its coding gene and application. Background technique [0003] For many years, humans have generally used chemical control methods to prevent and control mosquitoes. However, due to the long-term and large-scale use of chemical pesticides, they have polluted the environment and brought harm to human survival and health. In addition, while chemical pesticides kill pests, they also kill natural enemies and other beneficials, destroying the ecological balance. Compared with chemical control, biological control is safe, effective and durable, and avoids a series of problems caused by chemical control. Among biopestici...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/20C12N15/32C12N1/21C07K14/325A01N63/00A01N63/02A01P7/04A01H5/00
Inventor 朱军王世全李平张钦斌李巧邓其明李双成郑爱萍王玲霞刘怀年
Owner SICHUAN AGRI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com