Unlock instant, AI-driven research and patent intelligence for your innovation.

SCAR marker of biocontrol Hypocrea virens, its application and quantitative detection method

A kind of Trichoderma viride, labeling technology, applied in the field of bioengineering

Inactive Publication Date: 2013-09-11
CHINA NAT RICE RES INST
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the viability of the transgenic strain, this method is more suitable for experimental conditions with precise control of various factors, and as a transgenic strain, there will be controversy whether it is consistent with wild-type Trichoderma

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • SCAR marker of biocontrol Hypocrea virens, its application and quantitative detection method
  • SCAR marker of biocontrol Hypocrea virens, its application and quantitative detection method
  • SCAR marker of biocontrol Hypocrea virens, its application and quantitative detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Embodiment 1: Biocontrol Trichoderma viridans ( Hypocrea virens ) Isolation and identification of SS161

[0026] Take 0.5-1 gram of rotten straw in the seedling tray, add 200ml of sterile water, shake at 120 rpm, 28 degrees Celsius for 30 minutes, let it stand for 10 minutes, take 100 microliters of supernatant and apply it to a modified Martin medium plate (formulation: KH 2 PO 4 1 g, glucose 10 g, MgSO 4 ·7H 2O 0.5 g, peptone 5.0 g, 1 / 3000 Bengal red aqueous solution 100 ml, add 1000 ml water, natural pH value, add streptomycin solution to a final concentration of 0.003% before use, add 18 g agar, sterilize), and culture in the dark at 28 °C After colony growth and unit cell separation and purification, the antagonism of each strain against various pathogenic fungi was tested by confrontation culture method, among which the antagonism of strain SS161 was the strongest, and further research was carried out.

[0027] The strain has the following biological properti...

Embodiment 2

[0031] Embodiment 2: SCAR marker screening of biological control Trichoderma viridans SS161

[0032] The present invention utilizes 128 RAPD random primers to amplify SS161 and 12 control strains. Control strains, as shown in the table below.

[0033]

[0034] The PCR amplification system is 20 μL, including 2.0 μL buffer (10 × ), 1.5 μL 25 mmol / L MgCI 2 , 2.0 μL 1.0 mmol / L dNTP, 2.4 μL 5 μmol / L primer, 0.4 μL 5 U / μL Taq DNA polymerase, 2.0 μL DNA (6 ng). In this experiment, RAPD primers were synthesized by Shanghai Sangon Bioengineering Co., Ltd.

[0035] The PCR amplification conditions were pre-denaturation at 94°C for 2 min, followed by cycling, denaturation at 94°C for 1 min, annealing at 35°C for 1 min, extension at 72°C for 2 min, and extension at 72°C for 10 min after 40 cycles. After the amplification reaction was completed, 1.5% agarose gel electrophoresis was performed, observed and photographed on a UV gel imaging system.

[0036] Among them, the random pri...

Embodiment 3

[0041] Embodiment 3: the identification of biological control Trichoderma viridans SS161

[0042] (1) The control Trichoderma strain selected for this example:

[0043] A total of 12 control strains were selected, among which T. virens 4 strains, T.viride 3 strains, T. harzianum 2 strains, T. atroviride 2 strains, T. hamatum 1 strain, as shown in the table of Example 2.

[0044] (2) Synthetic primer pair for identification of Trichoderma viridans SS161 SCAR marker

[0045] Upstream primer TV163F: 5'GCTTTCGTTGCGTTTTGACC 3', the sequence is shown in SEQ ID NO: 2;

[0046] Downstream primer TV163R: 5'CCAGTACCGTTCTGGCGC 3', the sequence is shown in SEQ ID NO: 3;

[0047] Primers were synthesized by Shanghai Boshang Biotechnology Co., Ltd.

[0048] (3) PCR amplification reaction

[0049] The reaction system is:

[0050] DNA template 1 μL

[0051] Upstream primer (12.5μM) 0.5μL

[0052] Downstream primer (12.5μM) 0.5μL

[0053] dNTP mixture (2.5mM each) 2μL

[00...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Belonging to the technical field of bioengineering, the invention relates to an SCAR (sequence-characterized amplified region) marker of biocontrol Hypocrea virens, its application and quantitative detection method. The sequence of the marker is shown as SEQ ID NO:1. According to the invention, an RAPD (random amplified polymorphic DNA) technology is employed to analyze the Hypocrea virens SS161 and 12 strains of the same species and genus to successfully screen a specific fragment of the Hypocrea virens SS161, after recovery and sequencing of the specific fragment, the SCAR marker of the Hypocrea virens SS161 can be obtained by cloning. Fluorescent quantitative PCR primers and a TaqMan probe can be designed based on the sequence, and by means of continuous optimization, the real-time quantitative PCR detection method of the biocontrol Hypocrea virens SS161 is successfully established and developed. The quantitative detection method provided in the invention can be used for identification and tracking detection of the biocontrol Hypocrea virens SS161. The invention provides a simple and efficient method for studying the ecological adaptability of Trichoderma spp. in soil and other natural environments and judging whether trichoderma biocontrol bacteria are applicable in actual production. The method has important studying and application value.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and in particular relates to a SCAR marker for biological control of Trichoderma viride and its application and quantitative detection method. Background technique [0002] Trichoderma spp. is widely distributed in soil and is an important class of biocontrol fungi with great potential in the control of crop soil-borne and seed-borne diseases. Trichoderma has received extensive research and attention worldwide because of its important economic production value in enzymes, antibiotics and biocontrol. Since the mycoparasitic phenomenon of Trichoderma was discovered in 1932 (Weindling et al., 1932), there have been more and more studies on the biocontrol characteristics of Trichoderma. According to reports, this genus of fungi has antagonistic effects on at least 20 species of pathogenic fungi and a variety of pathogenic bacteria in 18 genera, and has been successfully used in the control of...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/11C12Q1/68C12Q1/06C12R1/885
Inventor 刘连盟黄世文王玲
Owner CHINA NAT RICE RES INST