SCAR marker of biocontrol Hypocrea virens, its application and quantitative detection method
A kind of Trichoderma viride, labeling technology, applied in the field of bioengineering
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] Embodiment 1: Biocontrol Trichoderma viridans ( Hypocrea virens ) Isolation and identification of SS161
[0026] Take 0.5-1 gram of rotten straw in the seedling tray, add 200ml of sterile water, shake at 120 rpm, 28 degrees Celsius for 30 minutes, let it stand for 10 minutes, take 100 microliters of supernatant and apply it to a modified Martin medium plate (formulation: KH 2 PO 4 1 g, glucose 10 g, MgSO 4 ·7H 2O 0.5 g, peptone 5.0 g, 1 / 3000 Bengal red aqueous solution 100 ml, add 1000 ml water, natural pH value, add streptomycin solution to a final concentration of 0.003% before use, add 18 g agar, sterilize), and culture in the dark at 28 °C After colony growth and unit cell separation and purification, the antagonism of each strain against various pathogenic fungi was tested by confrontation culture method, among which the antagonism of strain SS161 was the strongest, and further research was carried out.
[0027] The strain has the following biological properti...
Embodiment 2
[0031] Embodiment 2: SCAR marker screening of biological control Trichoderma viridans SS161
[0032] The present invention utilizes 128 RAPD random primers to amplify SS161 and 12 control strains. Control strains, as shown in the table below.
[0033]
[0034] The PCR amplification system is 20 μL, including 2.0 μL buffer (10 × ), 1.5 μL 25 mmol / L MgCI 2 , 2.0 μL 1.0 mmol / L dNTP, 2.4 μL 5 μmol / L primer, 0.4 μL 5 U / μL Taq DNA polymerase, 2.0 μL DNA (6 ng). In this experiment, RAPD primers were synthesized by Shanghai Sangon Bioengineering Co., Ltd.
[0035] The PCR amplification conditions were pre-denaturation at 94°C for 2 min, followed by cycling, denaturation at 94°C for 1 min, annealing at 35°C for 1 min, extension at 72°C for 2 min, and extension at 72°C for 10 min after 40 cycles. After the amplification reaction was completed, 1.5% agarose gel electrophoresis was performed, observed and photographed on a UV gel imaging system.
[0036] Among them, the random pri...
Embodiment 3
[0041] Embodiment 3: the identification of biological control Trichoderma viridans SS161
[0042] (1) The control Trichoderma strain selected for this example:
[0043] A total of 12 control strains were selected, among which T. virens 4 strains, T.viride 3 strains, T. harzianum 2 strains, T. atroviride 2 strains, T. hamatum 1 strain, as shown in the table of Example 2.
[0044] (2) Synthetic primer pair for identification of Trichoderma viridans SS161 SCAR marker
[0045] Upstream primer TV163F: 5'GCTTTCGTTGCGTTTTGACC 3', the sequence is shown in SEQ ID NO: 2;
[0046] Downstream primer TV163R: 5'CCAGTACCGTTCTGGCGC 3', the sequence is shown in SEQ ID NO: 3;
[0047] Primers were synthesized by Shanghai Boshang Biotechnology Co., Ltd.
[0048] (3) PCR amplification reaction
[0049] The reaction system is:
[0050] DNA template 1 μL
[0051] Upstream primer (12.5μM) 0.5μL
[0052] Downstream primer (12.5μM) 0.5μL
[0053] dNTP mixture (2.5mM each) 2μL
[00...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap