Taqman Real-time RT-PCR (reverse transcription-polymerase chain reaction) kit for detecting PRRSV (porcine reproductive and respiratory syndrome virus)
A kit, the technology of pmd-228, is used in the determination/inspection of microorganisms, fluorescence/phosphorescence, biochemical equipment and methods, etc. The effect of detecting, avoiding infection, preventing contamination
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] 1. Design and preparation of primers
[0029] Refer to GenBank (gene bank) to find ten strains, find the conserved regions on each sequence through sequence comparison, select the conserved regions and design a pair of amplification primers and a probe primer, the sequence is as follows:
[0030] The amplification primer sequences are:
[0031] SEQ ID NO: 1: Upstream primer CCCGGGTTGAAAAGCCTCGTGT,
[0032] SEQ ID NO: 2: Downstream primer GGCTTCTCCGGGTTTTTCTTCCTA.
[0033] The probe primer sequence is:
[0034] SEQ ID NO: 3: TGGCAGAAAAGCTGTTAAAGCAGGGAGTGGT.
[0035] The above primers were synthesized and labeled by Dalian Bao Biological Engineering Co., Ltd.
[0036] Positive control: The positive control of the kit of the present invention was constructed and preserved by the Lanzhou Veterinary Research Institute of the Chinese Academy of Agricultural Sciences.
[0037] 2. Prepare the kit
[0038] This kit consists of the following components:
[0039] a. 2×One S...
Embodiment 2
[0052] Step 1-2 is the same as embodiment 1
[0053] 3. The method for detecting porcine reproductive and respiratory syndrome virus with the kit of the present invention
[0054] (1) The total PCR system is 25 μl, respectively a. 2×One Step RT-PCR bufferIII: 12.5 μL; b. Ex Taq HS: 0.5 μL; c. PrimerScript RT Enzyme Mix II: 0.5 μL; d. A total of 3 μl of three primers; f. 6.5 μl of RNase-free water, added to a 0.2 ml amplification tube;
[0055] (2) Add 3 μl of positive control, 3 μl of RNA template extracted from whole blood of pigs to be tested, and 3 μl of negative control to the above-mentioned amplification tube, centrifuge at 12000rpm for 5-30 seconds, and put the amplification tube into the amplification instrument In the process, amplification was performed under the following setting procedures: reverse transcription at 42°C for 5 min; pre-denaturation at 94°C for 2 min; 94°C for 20 s, annealing temperature at 57°C for 30 s, and 72°C for 20 s, 40 cycles. Directly obse...
Embodiment 3
[0059] Step 1-2 is the same as embodiment 1
[0060] 3. The method for detecting porcine reproductive and respiratory syndrome virus with the kit of the present invention
[0061] (1) The total PCR system is 25 μl. In the kit of the present invention, a. 2×One Step RT-PCR bufferIII: 12.5 μL; b. Ex Taq HS: 0.5 μL; c. PrimerScript RT Enzyme Mix II: 0.5 μL; d. a total of 3 μl of three primers; f . 6.5 μl of RNase-free water was added to the 0.2 ml amplification tube;
[0062] (2) Add 3 μl of positive control, 3 μl of RNA template extracted from pig serum to be tested, and 3 μl of negative control to the above-mentioned amplification tubes, centrifuge at 12000 rpm for 5-30 seconds, and put the amplification tubes into the amplification instrument , Amplified under the following setting program: reverse transcription at 42°C for 5 minutes; pre-denaturation at 94°C for 2 minutes; 94°C for 20 s, annealing temperature at 57°C for 30 s, 72°C for 20 s, 40 cycles. Directly observe the...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
