Meloidogyne molecular identification primer set, and preparation method and application thereof

A root-knot nematode and molecular identification technology, applied in the fields of biotechnology and genetic engineering, can solve the problems of long time-consuming, insensitive, complicated operation, etc.

Inactive Publication Date: 2013-10-09
TOBACCO RES INST CHIN AGRI SCI ACAD
View PDF5 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] 1. The operation is complex, time-consuming and insensitive;
[0006] 2. The method based on PCR detection has few primers to choose from, so only two or a few kinds of nematodes can be identified;
[0007] 3. Molecular evolution research cannot be carried out systematically, and the identification of physiological races is very difficult

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Meloidogyne molecular identification primer set, and preparation method and application thereof
  • Meloidogyne molecular identification primer set, and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0069] The genome sequencing of Meloidogyne incognita and Meloidogyne incognita have been completed by French and American scientists respectively. Genomic sequence data and predictions can be downloaded from the genome databases of Meloidogyne infra (http: / / www.inra.fr / meloidogyne_incognita) and Meloidogyne (http: / / www.pngg.org / cbnp / index.php) Gene and protein sequence data.

[0070] a. The sequence comparison software Exonerate can be used to align the predicted protein sequences of Meloidogyne incognita with Meloidogyne incognita and Meloidogyne incognita genomes respectively, and set the similarity of the aligned sequences, that is, the percent parameter to 75. The similarity setting in this step is relatively loose, filtering multiple copies of homologous gene families as much as possible to obtain single copy genes. The Perl program was used to screen single-copy genes from the comparison results, and the sequence information of single-copy genes in the two genomes was ext...

Embodiment 2

[0079] One of the primer pairs in Example 1 was used to identify root knot nematodes in the sample.

[0080] (1) Collect samples of root knot nematodes in the south, north and Florida. Wash the nematodes in ddH2O, pick a single nematode and put it into a 200μL PCR tube (containing 8μL ddH 2 O and 1 μL 10X PCR buffer), place in liquid nitrogen for 1 minute, heat at 85°C for 2 minutes, add 1 μL of 1 mg / mL proteinase K to the PCR tube, heat at 56°C for 15 minutes, and heat at 95°C for 10 minutes to obtain a nuclear genomic DNA extract.

[0081] (2) Amplify the obtained nuclear genomic DNA extract directly, and the PCR primer pair used is WBMinc00222:

[0082] Upstream primer WBMinc00222.L: tcataacatcaatagaggat

[0083] And the downstream primer WBMinc00222.R: cgaaacaatgctgccgtaca;

[0084] The PCR reaction system is: 10XPCR buffer (no Mg 2+ ) 5ul, 25mmol / L MgCl 2 5ul, 0.1mmol / L dNTP4ul, 10umol / L upstream primer and downstream primer, 5U / uL Tag enzyme 0.6uL, plus DNA extract to supplement ...

Embodiment 3

[0088] One of the primer pairs in Example 1 was used to identify root knot nematodes in the sample.

[0089] (1) Collect samples of root knot nematodes in the south, north and Florida. Put the nematode into ddH 2 O wash, pick a single nematode and put it in a 200μL PCR tube (containing 8μL ddH 2 O and 1 μL 10X PCR buffer), place in liquid nitrogen for 1 minute, heat at 85°C for 2 minutes, add 1 μL of 1 mg / mL proteinase K to the PCR tube, heat at 56°C for 15 minutes, and heat at 95°C for 10 minutes to obtain a nuclear genomic DNA extract.

[0090] (2) Amplify the obtained nuclear genomic DNA extract directly, using PCR primer pair as WBMinc00818:

[0091] Upstream primer WBMinc00818.L: aatgttattggaactaattt

[0092] And the downstream primer WBMinc00818.R: tccatagcacgcattgcttg;

[0093] The PCR reaction system is: 10XPCR buffer (no Mg 2+ ) 5ul, 25mmol / L MgCl 2 5ul, 0.1mmol / L dNTP4ul, 10umol / L upstream primer and downstream primer, 5U / uL Tag enzyme 0.6uL, plus DNA extract to supplement dd...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a Meloidogyne molecular identification primer set which is prepared by the following steps: by comparing a predicted south Meloidogyne protein sequence respectively with south Meloidogyne genome and north Meloidogyne genome, setting the similarity of the comparison sequence, i.e. the percent parameter is 75, thereby obtaining the single-copy gene; by comparing the single-copy gene protein sequence respectively with the south Meloidogyne genome and the north Meloidogyne genome, setting the similarity of the comparison sequence, i.e. the percent parameter is 85, and screening the conserved single-copy gene in both of the two genomes; screening the gene of which the introne length difference between the two genomes is greater than 200bp; and designing primers on the basis of the exon sequences on two sides of the difference introne. Abundant primers are provided to enhance the detection accuracy; and the difference between the PCR (polymerase chain reaction) products of the primers via agarose gel electrophoresis is more than 200bp, and thus, the primers can be identified conveniently.

Description

Technical field [0001] The invention belongs to the technical field of biotechnology and genetic engineering, and relates to the technical field of root-knot nematode gene research and application, in particular to a root-knot nematode molecular identification primer set and its preparation method and application. Background technique [0002] Plant root knot nematodes (Meloidogyne) are obligate endoparasites in plant roots. Because of their wide distribution and multi-parasitic properties, they are the main pathogens and phytosanitary objects that threaten agricultural production worldwide. At present, there are more than 80 kinds of root knot nematodes described in detail, among which the most harmful are the southern root knot nematode (M.incognita), northern root knot nematode (M.hap1a), root knot nematode (M javanica) and peanut. Root knot nematode (M.arenaria). It has caused serious losses to most food crops, oil crops, fiber crops, tobacco, tea, fruit trees, vegetables, m...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
Inventor龚达平解敏敏孙玉合晁江涛
OwnerTOBACCO RES INST CHIN AGRI SCI ACAD