Method for preparing bacterial nucleic acid fingerprint characteristic spectrum library

A fingerprint feature, bacterial nucleic acid technology, applied to microorganism-based methods, biochemical equipment and methods, DNA preparation, etc.

Active Publication Date: 2013-10-16
BIOYONG TECH
View PDF6 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Since this method uses conventional processing (treatment with absolute ethanol, formic acid and acetonitrile, supplemented by centrifugation, and finally aspirating the supernatant for detection), although it can characterize the characteristic map of the bacterium to a certain extent, it is still pending The test object contains proteins, lipids, lipopolysaccharides and lipooligosaccharides, DNA, polypeptides and other molecules that can be ionized. The amount of information in the map is too large, and the characteristic of the map is low due to the large number of molecules to be detected. It is only applicable to a specific bacterium and cannot be extended to other large numbers of bacterial detection.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for preparing bacterial nucleic acid fingerprint characteristic spectrum library
  • Method for preparing bacterial nucleic acid fingerprint characteristic spectrum library
  • Method for preparing bacterial nucleic acid fingerprint characteristic spectrum library

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0079] Example 1. The establishment of a single bacterial nucleic acid fingerprint feature map

[0080] 1. Design and select universal primers

[0081] According to the conserved region (SEQ ID No: 3) of the 16S rDNA of Listeria monocytogenes (Listeria monocytogenes EGD-e, NCBI accession number: NC_003210.1), design universal PCR primers, respectively:

[0082] 5-aggaagagagAGAGTTTGATCCTGGCTCAG-3 (SEQ ID No: 1);

[0083] 5-cagtaatacgactcactatagggagaaggctCTGCTGCGTCCCGTAG-3 (SEQ ID No: 2)

[0084] Among them, the sequences AGAGTTTGATCCTGGCTCAG and CTGCTGCGTCCCGTAG respectively match the 16S rDNA region to be amplified, and aggaagagag and cagtaatacgactcactatagggagaaggct are additional sequences added to the upstream and downstream PCR primers to ensure that the 5' end of the primer of SEQ ID No: 1 contains 10 bp in order to transcribe the PCR product The tag (aggaagagag), the 5' end of the primer of SEQ ID No: 2 contains a 31bp tag (cagtaatacgactcactatagggagaaggct). Relevant pr...

Embodiment 2

[0099] Example 2, small-scale verification of the preparation method of the nucleic acid fingerprint characteristic map of implementation 1

[0100] Using the method and primers described in Example 1, Acetobacter pasteurianus IFO3283-01 and Azorhizobium caulinodans ORS571chromosome were digested and identified by mass spectrometry.

[0101] Repeat twice to get the same nucleic acid fingerprint feature spectrum, where figure 2 , image 3 The nucleic acid fingerprint characteristic maps of Acetobacter and nitrogen-fixing rhizobia are shown respectively.

Embodiment 3

[0102] Embodiment 3, the establishment of the nucleic acid fingerprint feature map library of bacteria

[0103] According to the method and primers described in Example 1, the bacteria listed in Table 1 were digested and identified by mass spectrometry, and the nucleic acid fingerprints of all bacteria were obtained.

[0104] These feature maps are integrated and analyzed by Bioexplore software to obtain a nucleic acid fingerprint feature map library including most bacteria.

[0105] As shown in table 2, Figure 4 - Figure 100 The nucleic acid fingerprint feature maps of 97 kinds of bacteria are displayed respectively.

[0106] Table 2 (Note: Table 2 is the content in italics in Table 1)

[0107]

[0108]

[0109] Figures 101-103 It is the nucleic acid fingerprint characteristic map of sheep, cattle, and suis Brucella, Figure 104 It is the nucleic acid fingerprint characteristic map of Mycobacterium tuberculosis, Figure 105 It is the nucleic acid fingerprint char...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention discloses a method for preparing a bacterial nucleic acid finger print library, wherein the method comprises PCR amplification, SAP enzyme digestion, transcription, nucleic acid digestion through enzyme, purification, mass spectrometer detection and other steps. According to the present invention, based on the method, a nucleic acid finger print library of the common bacterial is established; and according to a mass spectrum characteristic spectrum library produced by experiments, classification and identification can be performed on bacterial to be detected, and results can be widely used for bacterial classification and identification, phylogenetic analysis, drug screening, import and export inspection and other fields.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to a method for preparing bacterial nucleic acid fingerprints and a method for classifying and identifying bacteria using the method. Background technique [0002] The early bacteriological classification mainly adopted the traditional bacteriological classification method based on morphological and cultural characteristics and physiological and biochemical characteristics. However, because the surface characteristics of bacteria are often affected and limited by many human factors, especially the differences in people's subjective judgments, it is difficult to reflect the natural kinship of bacteria, which reflects the fact that bacteria are only based on morphological characteristics and physiological and biochemical characteristics. limitations of traditional taxonomies. [0003] Therefore, Colweel proposed a new bacterial taxonomy term "Polyphasic taxonomy", which refers to the metho...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C40B50/06C12Q1/68C12Q1/04C12N15/10C12R1/01C12R1/32
Inventor张学记马庆伟赵洪斌张海燕赵艳梅
OwnerBIOYONG TECH