Check patentability & draft patents in minutes with Patsnap Eureka AI!

5'-bit modified puromycin compound, and preparation method and applications thereof

A kind of technology of puromycin and compound, which is applied in the field of chemical invention and achieves the effect of easy commercialization and easy preparation

Active Publication Date: 2013-11-06
CHENGDU INST OF BIOLOGY CHINESE ACAD OF S
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The realization of DNA display technology needs to link puromycin to the 5' end of DNA, while the existing method can only link puromycin to the 3' end of DNA

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • 5'-bit modified puromycin compound, and preparation method and applications thereof
  • 5'-bit modified puromycin compound, and preparation method and applications thereof
  • 5'-bit modified puromycin compound, and preparation method and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0017] Embodiment 1 (synthetic steps)

[0018] For the chemical modification reaction steps of puromycin, see figure 2 . The specific operation steps are as follows:

[0019] a. Weigh 100mg of puromycin and place it in an eggplant-shaped bottle, add 2ml of freshly distilled acetonitrile, ultrasonically sonicate for half an hour, place the resulting solution in an ice-water bath, stir and cool to 0°C, and slowly Add 60ul of triethylamine, and after the solution is clear, dissolve 72mg of fluorenylmethoxycarbonyl succinimide (Fmoc-Osu) in 1ml of acetonitrile, add it dropwise to the above reaction solution at 0°C, and continue to stir. After 30min, the solution becomes As a white turbid liquid, the reaction was slowly raised to room temperature and stirred for 1 h until the completion of the reaction monitored by TLC, filtered with a Buchner funnel to obtain a white solid crude product; the obtained crude product was further purified by silica gel column chromatography to obta...

Embodiment 2

[0031] Embodiment 2, figure 2 The modified puromycin is connected to a fixed sequence of DNA. The reaction steps are basically the same as the widely used solid-phase phosphoramidite triester method, and the coupling product is obtained by high-performance liquid phase separation and purification. As shown in the figure: Spacer18 near the 5' end of DNA represents polyethylene glycol with 12 carbons, and rC represents the base reversed in the 5'-3' direction on the oligonucleotide chain.

Embodiment 3

[0032] Example 3. In vitro screening of polypeptides by means of 5' modified puromycin

[0033] For the procedure of screening proteins in vitro, see image 3 .

[0034] (1) Construction of a double-stranded DNA library containing random sequences. Synthesize a single-stranded DNA library with random sequences by chemical methods, add equal concentrations of downstream primers for two cycles of PCR amplification, and finally obtain T7 promoters, enhancers, start codons, random sequences, and affinity purification Double-stranded DNA random library of tag-encoding sequences.

[0035] Single-stranded DNA random sequence:

[0036] TAATACGACTCACTATAGGAGGACGAAATG(NNN) 9 CACCACCACCATCATCATCAGC TGCGTAACTC

[0037] Downstream primer: GAG TTA CGC AGC TGA TGA

[0038] Reaction system and PCR conditions:

[0039]

[0040]

[0041] The PCR conditions are: preheating at 95°C for 1min; denaturation at 95°C for 30s, renaturation at 45°C for 45s, extension at 72°C for 45s, 2 cycl...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of chemical invention technology, and relates to a 5'-bit modified puromycin compound, and a preparation method and applications in drug screening thereof. The structure formula of the 5'-bit modified puromycin compound is described as following: R1 is protecting group Fmoc, Boc or Cbz; and R2 is protecting group Ac, Bz or Pv. The 5'-bit modified puromycin compound can be connected to the 5'-terminal of an oligonucleotide chain by solid phase phosphoramidite triester method, and is used for polypeptide medicine screening. The preparation method is simple, synthetic efficiency is high, and the 5'-bit modified puromycin compound is suitable for commercial synthesis.

Description

technical field [0001] The invention belongs to the technical field of chemical inventions, and specifically relates to a 5'-modified puromycin compound and a preparation method and application thereof. Background technique [0002] In recent years, protein in vitro screening technology has been rapidly developed, including early phage display (Phage display), plasmid display (Plasmic display) and cell display (Cell display). When cell transfection is involved, the library capacity is limited to 10 9 ~10 10 , which reduces the efficiency of library screening. In addition, once the phage display library is built, it is difficult to carry out effective in vitro mutation and recombination, which limits the diversity of molecular genetics in the library. In this context, J.W.Szostak of Harvard Medical School in the United States established a protein screening technology called mRNA display, which mainly uses the A site that puromycin can enter ribosomes when expressed and the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07H19/167C07H1/00C40B50/06C40B30/00C40B40/10
CPCY02P20/55
Inventor 唐卓陈浩东
Owner CHENGDU INST OF BIOLOGY CHINESE ACAD OF S
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com