Unlock instant, AI-driven research and patent intelligence for your innovation.

A screening method for ret fusion gene

A technology that combines genes and screening, applied in the fields of medicine and biology, can solve problems such as extremely high technical requirements for operators, inability to effectively detect, complicated experimental steps, etc., and achieve intuitive result judgment, high scientific research and clinical use value , the effect of simple operation

Inactive Publication Date: 2015-09-16
FUDAN UNIV SHANGHAI CANCER CENT
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Clinical practice shows that the common PCR screening method currently described has the following obvious defects: since there are more than 16 specific forms of the RET fusion gene, at least 16 pairs of PCR primers need to be designed, and 16 PCR reactions are performed respectively, which is time-consuming Laborious; moreover, if the sample is a novel RET fusion (with an unknown "partner gene"), it cannot be efficiently detected using this method, giving false negative results
For fluorescence in situ hybridization (FISH), although it is currently considered the gold standard for diagnosing fusion genes, its high price, complicated experimental steps, and extremely high requirements on the technical level of operators make it impossible to promote it

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A screening method for ret fusion gene
  • A screening method for ret fusion gene
  • A screening method for ret fusion gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Embodiment 1 real-time fluorescent quantitative double-labeled probe PCR method

[0031] 1. Extract the total RNA in the sample and convert it into cDNA.

[0032] 2. Primer and probe design

[0033] Primer pair I

[0034] Upstream primer: GCGTCCTCTTGCTCCACTTC (SEQ ID NO 1)

[0035] Downstream primer: ATGCCTGGCAGTTTTCCACAC (SEQ ID NO 2)

[0036] Primer pair II

[0037] Upstream primer: CACCGACCAGCAGACCTCTA (SEQ ID NO 3)

[0038] Downstream primer: GCCACACTCCTCACACTCCA (SEQ ID NO 4)

[0039] Primer pair III

[0040] Upstream primer: AGCAAGAGACGGCTGGAGTGT (SEQ ID NO 5)

[0041] Downstream primer: GTCTTGGTGCTGGGAGAGCA (SEQ ID NO 6)

[0042] Primer pair IV

[0043] Upstream primer: TGGCCGAGATGAAGCTCGTT (SEQ ID NO 7)

[0044] Downstream primer: TGGCTCCTCTTCACGTAGGAATC (SEQ ID NO 8)

[0045] Primer pair V

[0046] Upstream primer: ACCACGCAAAGTGATGTATGGTC (SEQ ID NO 9)

[0047] Downstream primer: GCAGTTGTCTGGCCTCTCCATC (SEQ ID NO 10)

[0048] 3. Reaction system (10u...

Embodiment 2

[0057] Example 2 In vitro sample screening

[0058] In vitro samples for screening were taken by conventional methods. This method was used to screen 936 cases of non-small cell lung cancer in vitro samples containing RET fusion gene (SLC25A13 gene) mutations (Fudan University Cancer Hospital). A total of 13 cases of non-small cell lung cancer with RET fusion gene mutation were screened out, and the remaining 923 cases had no RET fusion gene mutation.

[0059] In order to further verify the accuracy of the method of the present invention, common PCR was carried out on 13 cases of non-small cell lung cancer with RET fusion gene mutation and 42 cases of non-small cell lung cancer without RET fusion gene mutation, and the PCR products were tested. Direct sequencing, the sequencing results were combined with software reading and manual checking, and the results showed that all 13 samples had RET fusion gene mutations; continue to use the gold standard FISH experiment for inspecti...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technology fields of medicine and biology, relates to a RET fusion gene screening method, and especially relates to a multi-clip primer for RET fusion gene screening and applications thereof. The RET fusion gene screening method comprises following steps: taking cDNA, which is reversed by total RNA, in a sample as the template, adding a real-time PCR combined primer presented by nucleotide coded sequence such as SEQ ID NO 1-10, carrying out real-time fluorescence polymerase chain reaction, and determining whether RET fusion gene mutation happens through detecting the Ct value of reaction units. The RET fusion gene screening method has the characteristics of convenient operation, time saving, direct and clear judge result, low cost and little pollution.

Description

technical field [0001] The invention belongs to the field of medicine and biotechnology, and relates to a screening method for RET fusion gene, in particular to a multi-segment primer for screening RET fusion gene and its application. Background technique [0002] The prior art discloses that Ret protein is a receptor tyrosine kinase that plays an important role in neuron development and cell proliferation, differentiation and migration. Its encoding gene RET is located on the long arm of human chromosome 10 and is of great significance in oncology. It is known that the RET gene is prone to breakage in its No. 11 intron. After the breakage, the 3' stump of the RET gene can be fused with various "partner genes" such as KIF5B, CCDC6 or NCOA4 to form a "RET fusion gene" and produce corresponding fusion protein. [0003] Studies have shown that the RET fusion gene is common in about 2% of lung adenocarcinoma, 20% of thyroid papillary carcinoma and other solid tumors, and has b...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68C12N15/11
Inventor 陈海泉孙艺华王瑞胡海川潘云建李晨光王磊叶挺罗晓阳李航张扬
Owner FUDAN UNIV SHANGHAI CANCER CENT