A screening method for ret fusion gene
A technology that combines genes and screening, applied in the fields of medicine and biology, can solve problems such as extremely high technical requirements for operators, inability to effectively detect, complicated experimental steps, etc., and achieve intuitive result judgment, high scientific research and clinical use value , the effect of simple operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] Embodiment 1 real-time fluorescent quantitative double-labeled probe PCR method
[0031] 1. Extract the total RNA in the sample and convert it into cDNA.
[0032] 2. Primer and probe design
[0033] Primer pair I
[0034] Upstream primer: GCGTCCTCTTGCTCCACTTC (SEQ ID NO 1)
[0035] Downstream primer: ATGCCTGGCAGTTTTCCACAC (SEQ ID NO 2)
[0036] Primer pair II
[0037] Upstream primer: CACCGACCAGCAGACCTCTA (SEQ ID NO 3)
[0038] Downstream primer: GCCACACTCCTCACACTCCA (SEQ ID NO 4)
[0039] Primer pair III
[0040] Upstream primer: AGCAAGAGACGGCTGGAGTGT (SEQ ID NO 5)
[0041] Downstream primer: GTCTTGGTGCTGGGAGAGCA (SEQ ID NO 6)
[0042] Primer pair IV
[0043] Upstream primer: TGGCCGAGATGAAGCTCGTT (SEQ ID NO 7)
[0044] Downstream primer: TGGCTCCTCTTCACGTAGGAATC (SEQ ID NO 8)
[0045] Primer pair V
[0046] Upstream primer: ACCACGCAAAGTGATGTATGGTC (SEQ ID NO 9)
[0047] Downstream primer: GCAGTTGTCTGGCCTCTCCATC (SEQ ID NO 10)
[0048] 3. Reaction system (10u...
Embodiment 2
[0057] Example 2 In vitro sample screening
[0058] In vitro samples for screening were taken by conventional methods. This method was used to screen 936 cases of non-small cell lung cancer in vitro samples containing RET fusion gene (SLC25A13 gene) mutations (Fudan University Cancer Hospital). A total of 13 cases of non-small cell lung cancer with RET fusion gene mutation were screened out, and the remaining 923 cases had no RET fusion gene mutation.
[0059] In order to further verify the accuracy of the method of the present invention, common PCR was carried out on 13 cases of non-small cell lung cancer with RET fusion gene mutation and 42 cases of non-small cell lung cancer without RET fusion gene mutation, and the PCR products were tested. Direct sequencing, the sequencing results were combined with software reading and manual checking, and the results showed that all 13 samples had RET fusion gene mutations; continue to use the gold standard FISH experiment for inspecti...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 