A promoter predominantly expressed during fiber elongation, its preparation method and application

A technology of promoter and cotton fiber, applied in the field of plant genetic engineering

Inactive Publication Date: 2015-09-30
HUAZHONG AGRI UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there are relatively few related studies on functional verification of cotton fiber development-related genes using existing fiber-specific promoters

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A promoter predominantly expressed during fiber elongation, its preparation method and application
  • A promoter predominantly expressed during fiber elongation, its preparation method and application
  • A promoter predominantly expressed during fiber elongation, its preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0096] Example 1: GhGLP2 and GbGLP3 expression analysis

[0097] The 3'-UTR of GhGLP2 and GbGLP3 was used to design primers for RT-PCR to verify their expression patterns. The DNA sequence of the primer is as follows:

[0098] GhGLP2Sense: 5'ACACTTTTTGCTGGTTTCATA 3'

[0099] GhGLP2Anti: 5'TAAACAAGGCAAAGTCCAGG 3'

[0100] GbGLP3Sense: 5'GACATTATGGTTTTCCCACG 3'

[0101] GbGLP3Anti: 5' TTTTTGCAATAACGCCAGTA 3'

[0102] The RT-PCR steps are as follows: Extract total RNA from different tissues: leaves, roots and 3, 5, 8, 10, 13, 15, 17, 23 DPA (days post anthesis) fibers of upland cotton TM-1; Fibers of 3, 5, 10, 15, and 20 DPA of sea-island cotton 3-79 and ovules on the day of flowering. After the RNA was extracted, it was treated with DNaseI (purchased from Promega), and the integrity of the RNA was detected by 1.4% (w / v) agarose gel (EtBr) electrophoresis (5V / cm). The determination of nucleic acid concentration was carried out on a Beckman DU800 spectrophotometer. The RNA ...

Embodiment 2

[0104] Example 2: Obtaining the sequences of promoters PGhGLP2 and PGbGLP3

[0105] Design GSP1 (gene special primer gene-specific primer) and GSP2 with the full-length cDNA 3' end sequence, using GenomeWalker TM The method of Universal Kit (Protocol No.PT3042-2, Clontech) was used to clone the promoter (see the kit operation manual for specific steps).

[0106] GhGLP2FGSP1: GGTCCTTTGTACTTCAGGTGCTATC

[0107] GhGLP2RGSP2: GTTTATGGCACTGGTTTTTGAGGG

[0108] GbGLP3FGSP1: GCAGGGGTTGAAGGCAGTTAGAC

[0109] GbGLP3RGSP2: GTTTATGGCACTGGTTTTTGAGGG

[0110] After gel electrophoresis, the target fragment was recovered with a gel recovery kit (Qiagene, Germany Cat. No. 28704), followed by TA cloning and sequencing. The two promoters are 1332bp and 641bp in length respectively, and an isolated promoter is obtained, whose sequence is the nucleotide sequence shown in SEQ ID NO: 1, and an isolated promoter whose sequence is SEQ ID NO: 2 Nucleotide sequences shown.

Embodiment 3

[0111] Embodiment 3: Promoter PGhGLP2 and PGbGLP3 drive GUS to express in cotton

[0112] Add BP adapters at both ends of the two promoters, and connect to pGWB433 using gateway's BP and LR technology (Imp roved gateway binary vectors: high-performance vectors for creation of fusion constructs in transgenic analysis of plants, 2007, Biosci biotechmol biochem) vector, transformed cotton line YZ1 to test whether it is a fiber-specific promoter. The primer sequences are as follows (reverse primers for both promoters are the same):

[0113] PGhGLP2F:5'GGGGACAAGTTTGTACAAAAAAGCAGGCTNNGGTCCTTTGTACTTCAGGTGCTATC'3

[0114] PGbGLP3F:5'GGGGACAAGTTTGTACAAAAAAAGCAGGCTNNGCAGGGGTTGAAGGCAGTTAGAC'3

[0115] PhGLPR: 5'GGGGACCACTTTGTACAAGAAAGCTGGGTN GTTTATGGCACTGGTTTTTGAGGG'3

[0116]The method used for the cotton transgene involved in the present invention is the genetic transformation method mediated by Agrobacterium. The Agrobacterium strain used is LBA4404, and the transformation receptor...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a fiber elongation-stage predominant-expression promoter, and a preparation method and an application thereof. The promoter mainly predominantly expresses in an elongation stage, two promoters comprising PGhGLP2 and PGbGLP3 and GUS are fused, and the obtained fusion converts cotton, chemical dyeing of fibers shows that the two promoters comprising PGhGLP2 and PGbGLP3 do not express in ovules in the bloom day, the expression of the GUS can be detected in fibers from 1DPA, and the expression of the GUS cannot be detected in the ovules. The expression peaks of the two promoters are in the cotton fiber elongation stage. The elongation stage is a very key stage for the cotton fibers, and the utilization of the specific expression of some genes important to the formation of high-quality fibers by the promoter in the heredity improvement will increase the cotton output without influencing the growth of other tissues and organs.

Description

technical field [0001] The invention belongs to the technical field of plant genetic engineering. More specifically, it relates to a cotton fiber development stage-specific promoter and the application of a promoter predominantly expressed in the fiber elongation stage. By cloning and identifying two cotton fiber elongation-specific promoters, they were applied to the genetic transformation of cotton fiber quality improvement. Background technique [0002] Cotton fiber is an important raw material for the textile industry. The genetic improvement of cotton fiber is beneficial to the development of the cotton spinning industry. From the day of flowering, cotton fiber cells go through four stages: initiation, elongation, secondary wall deposition and maturity, and finally develop A fibroblast with a length of about 3 cm and a cellulose content of more than 90% in the secondary wall is formed. Therefore, the research on cotton fiber cells is an important means to improve fibe...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/113A01H5/00
Inventor 涂礼莉胡海燕谭家福张献龙
Owner HUAZHONG AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap