Unlock instant, AI-driven research and patent intelligence for your innovation.

A dsrna inhibiting the expression of wheat aphid gland protein mys2 gene and its application

A gland and protein technology, applied in the field of dsRNA, can solve problems such as the decline of target gene expression

Active Publication Date: 2016-01-20
INST OF CROP SCI CHINESE ACAD OF AGRI SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The process of RNAi is that double-stranded RNA (dsRNA) enters the organism and is cut into 21-23nt siRNA by Dicer enzyme. The siRNA binds to the RNA-induced silencing complex, binds to the target mRNA of complementary sequence, and is recognized by Dicer, resulting in the expression of the target gene decline in volume

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A dsrna inhibiting the expression of wheat aphid gland protein mys2 gene and its application
  • A dsrna inhibiting the expression of wheat aphid gland protein mys2 gene and its application
  • A dsrna inhibiting the expression of wheat aphid gland protein mys2 gene and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Example 1. Preparation of dsRNA for silencing glandular protein MYS2 gene

[0022] 1. Extract the total RNA of Aphid rubella and reverse transcribe it into cDNA.

[0023] 2. Using the cDNA obtained in step 1 as a template, perform PCR amplification with a primer pair composed of P1-F and P1-R to obtain a PCR amplification product. The agarose gel electrophoresis of the PCR amplification product is shown in figure 1 a.

[0024] P1-F (upstream primer): TAATACGACTCACTATAGGG AGGTTTGGATCGAGTGCTGGTCTAAAATGC;

[0025] P1-R (downstream primer): TAATACGACTCACTATAGGG AGGACCGCCGAAGACTTCAACGA.

[0026] The underlined region is the T7 promoter sequence.

[0027] PCR reaction system: 10×PCRBuffer 5μL, dNTP (2.5mmol L -1 ) 4 μL, rTaq 0.5 μL, upstream primer (20 μmol L -1 ) 1 μL, downstream primer (20 μmol L -1 ) 1 μL, template 1 μL, with ddH 2 O to make up to 50 μL.

[0028] PCR reaction conditions: 94°C for 4min; 39 cycles of 94°C for 30s, 55°C for 30s, and 72°C for 30s; ...

Embodiment 2

[0032] Embodiment 2, preparation of dsRNA for silencing GFP gene

[0033] 1. Synthesize the double-stranded DNA molecule shown in sequence 3 of the sequence listing.

[0034] 2. Using the double-stranded DNA molecule obtained in step 1 as a template, carry out PCR amplification with a primer pair composed of P4-F and P4-R to obtain a PCR amplification product. The agarose gel electrophoresis of the PCR amplification product is shown in figure 1 b.

[0035] P4-F (upstream primer): TAATACGACTCACTATAGGG ACGGGAACTACAAGACACG;

[0036] P4-R (downstream primer): TAATACGACTCACTATAGGG CTTTGGAAAGGGCAGATT.

[0037] The PCR reaction system and PCR reaction conditions are the same as those in Step 2 of Example 1.

[0038] 3. Preparation of dsRNA-2

[0039] The PCR amplification product obtained in step 2 was recovered and used as a template, and the T7 in vitro transcription kit was used for in vitro transcription (incubated at 42°C for 16 hours), and the residual template DNA and si...

Embodiment 3

[0041] Embodiment 3, the application of dsRNA in inhibiting the growth of aphids

[0042] 1. Preparation of artificial diet for aphids and preparation of feeder

[0043] For the artificial feed preparation method and the structure of the incubator, please refer to the reference (Li Caixia, Gao Lifeng, Gao Lingling, Li Runzhi. Research on raising aphids in pure artificial nutrient solution. Journal of Shanxi Agricultural University, 1997, 17(3): 225-228.LiCX . Filter the artificial feed with a bacterial filter with a pore size of 0.2 μm, dispense it into 2.0 mL sterilized centrifuge tubes, and store it in a -20°C refrigerator to avoid repeated freezing and thawing.

[0044] 2. Application of dsRNA in inhibiting the growth of aphids

[0045] See references for feeding methods of Aphid aphids: Jiao Min, Liu Shusheng. Techniques for feeding aphids with artificial diet. Acta Entomological Sinica East China, 2004, 13(2): 102-109. JiuM, LiuSS. Aphidrearing with artificial diets. En...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses dsRNA (double-strand ribose nucleic acid) capable of inhibiting wheat aphid salivary protein MYS2 gene expression and application thereof. The invention provides the double-stranded RNA molecule shown in the sequence 2 in a sequence table. The DNA (deoxyribonucleic acid) molecule encoding the RNA molecule and the application of the RNA molecule or DNA molecule are protected in the invention, and the application of RNA molecule or DNA molecule includes at least one of the following: (1) preventing and treating aphid; (2) promoting death of aphid; (3) inhibiting growth of aphid; and (4) inhibiting expression of in vivo salivary protein MYS2 gene of aphid. The dsRNA has important application value in prevention and control of aphid in agriculture production.

Description

technical field [0001] The invention relates to a dsRNA for inhibiting the expression of the wheat aphid gland protein MYS2 (salivaryprotein MYS2) gene and application thereof. Background technique [0002] Wheat aphids (especially wheat aphids) are one of the main pests that harm wheat production in China. According to statistics, the area damaged by wheat aphids in China every year can reach as high as 17 million hectares, accounting for 62% of the total wheat planting area, resulting in a 15% reduction in production- 30%, up to 50% in severe cases. In recent years, due to factors such as global warming and changes in farming systems, the reproductive ability and adaptability of aphids have been significantly enhanced, and their harm has become increasingly serious. At present, the control of aphids is mainly based on spraying pesticides, which are not only harmful to humans and animals, but also cause serious environmental pollution. Breeding aphid-resistant wheat varie...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/113A01N57/16A01P7/04
Inventor 夏兰琴王大海孙永伟杜文明
Owner INST OF CROP SCI CHINESE ACAD OF AGRI SCI