Using amRNAs to obtain a safe and alternative way to kill transgenic rice

A technology of genetically modified rice and extermination, applied in the field of genetic engineering

Inactive Publication Date: 2016-02-03
ZHEJIANG UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] There is currently no method for transgenic rice (bioreactor) that can express foreign proteins while being safe and selectively killable

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Using amRNAs to obtain a safe and alternative way to kill transgenic rice
  • Using amRNAs to obtain a safe and alternative way to kill transgenic rice
  • Using amRNAs to obtain a safe and alternative way to kill transgenic rice

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] Embodiment 1, Stem-loop backbone endogenous miRNA selection:

[0047] Stem-loop backbone endogenous miRNAs were selected from all rice miRNA precursors present in miR / Rfam by 2 criteria, which are as follows:

[0048] Criterion 1. The predicted secondary structure can form a short, simple hairpin stem-loop structure, and at the same time can form a complete miRNA-miRNA* matching endogenous miRNA precursor without insertion or deletion;

[0049] Criterion 2. The endogenous miRNA precursor sequence already exists in the EST database and is supported by corresponding literature.

[0050] osa-MIR528 (acquisition number: MI0003201; corresponding literature: NormanWarthmannetal, PLoSONE, 2008, 3(3).) meets the above two criteria.

[0051] The precursor of osa-MIR528 (acquisition number: MI0003201) can form a short stem-loop structure, and it exists and expresses in rice roots, leaves and other tissues (LiuBetal, PlantPhysiol2005, 139:296–305); via NCBI There are 3 EST seque...

Embodiment 2

[0053] Example 2. Artificial amiRNA selection:

[0054] WMD2 (http: / / wmd2.weigelworld.org) currently provides miRNA sequences of 21 bases in 38 plants including rice. It (WMD2) provides specific and effective candidate miRNAs through two-step screening. First, the The database software will regard all sequences whose 10th base in the input sequence is "A" or "U" and whose 5' end is unstable (5' high AU content, 3' high GC content) with a length of 21 bases as candidates miRNA, then replace the first base of all candidate miRNAs with "U", and then continuously replace 13-15 and 17-21 bases of candidate miRNAs based on specific species genes or sequences, which will be in the "seed region" (2-12 Base region) has no more than 1 base mismatch with the target sequence, and candidate miRNAs with 1 or 2 base mismatches at other positions are returned to the user as the final miRNA (SchwabRetal, PlantCell, 2006, 18:1121 –1133; Ossowski Setal, Plant J, 2008, 53:674–690; Schwab Retal, ...

Embodiment 3

[0060] Example 3, Construction of Rice Expression Vector 1300-35S-Ubq-1174-Ubq-CYP81A6i

[0061] Using primer miR1-F:AG TCAATACATGAGTTCGTCCGG CAGGAGATTCAGTTTGA (the underline represents the replacement base);

[0062] miR1-R:TG CCGGACGAACTCATGTATTGA CTGCTGCTGCTACAGCC (the underline represents the replacement base);

[0063] miR11-F: CT CCGGAgGAAgTCATGTATTGA TTCCTGCTGCTAGGCTG (underlines represent replacement bases, lowercase letters represent mismatched bases);

[0064] miR11-R:AA TCAATACATGAcTTCcTCCGG AGAGAGGCAAAAGTGAA (underlines represent replacement bases, lowercase letters represent mismatched bases);

[0065] Replace the 21bp base sequence in the 245bp endogenous miRNAosa-MIR528 (Note: miR1-R contains the amiRNA sense strand sequence, miR1-F contains the amiRNA antisense strand sequence, miR11-F contains the amiRNA* sense strand sequence, and miR11-R contains the amiRNA* sense strand sequence amiRNA* sense strand sequence).

[0066] Remarks: In SEQ ID NO: 1, the ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method of using amiRNAs to obtain safe and selective killing of transgenic rice: while expressing exogenous genes, endogenous miRNAs are used as precursors to selectively inhibit the expression of herbicide detoxification enzymes in rice, thereby obtaining safe, Genetically modified rice with optional kill. Specifically: the exogenous gene expression frame and the amiRNAs expression frame for directional inhibition of detoxification enzymes are constructed on the same plant expression vector; The sub-functionality is connected. The invention obtains a method for safely selecting and eradicating transgenic rice by directional silencing the expression of enzyme genes involved in herbicide detoxification and detoxification metabolism in rice.

Description

technical field [0001] The invention relates to a method for using amiRNAs to obtain safe and selectively killed transgenic rice, and the used genes and plasmids belong to the technical field of genetic engineering. Background technique [0002] Genetically modified crops have been widely promoted in many countries in the world, and my country is also vigorously developing and promoting transgenic technology and research. Currently, the use of transgenic crops as bioreactors to produce medicinal proteins, industrial enzymes and other research work is also in full swing (Larrick and Thomas, Current Opinion in Biotechnology, 2001, 12: 411-418). The planting of these genetically modified crops has the possibility of being mixed with non-genetically modified crops, resulting in important health and safety hazards and ecological safety hazards such as transgenic drift. [0003] Cytochrome P450 is a kind of heme protein that uses the electrons delivered by NADPH to catalyze the a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/84A01H5/00
Inventor刘明宏沈志成
OwnerZHEJIANG UNIV