Paddy rice leaf color control gene OscpSRP54 and protein encoded by same

A protein and gene technology, applied in the field of plant genetic engineering, can solve the problems of leaf color genes to be identified

Inactive Publication Date: 2014-03-05
CHINA NAT RICE RES INST
View PDF0 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Only a few rice leaf color mutant genes have been identified so far, and there are still a large number of leaf color genes to be identified

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Paddy rice leaf color control gene OscpSRP54 and protein encoded by same
  • Paddy rice leaf color control gene OscpSRP54 and protein encoded by same
  • Paddy rice leaf color control gene OscpSRP54 and protein encoded by same

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Example 1: Isolation and genetic analysis of mutants

[0028] Through the screening of the rice (IR64) mutant library induced by EMS, a rice leaf color mutant HM14 was isolated and obtained. figure 1 shown). The mutant HM14 was crossed with Moroberekan to obtain F1. The F1 plants had normal leaf color phenotypes. The segregation ratio of the wild-type and mutant phenotypes in the F2 generation was consistent with the segregation ratio of the Mendelian single recessive mutation, indicating that the mutant HM14 The light green leaf phenotype is controlled by a single recessive gene.

Embodiment 2

[0029] Example 2: Fine Mapping of Mutant Genes

[0030] According to the published molecular genetic maps of japonica and indica rice, SSR primers approximately uniformly distributed on each chromosome were selected for polymorphism detection and preliminary location analysis, and the mutant phenotype was found in the F2 population obtained by crossing mutant HM14 with Moroberekan A total of 1008 F2 individuals with mutant phenotype were identified, and 72 of them were used as the initial mapping population. The preliminary mapping results showed that the mutant gene was located between RM1812 and RM26092 on the short arm of chromosome 11.

[0031] The primers RM26076, RM26079 and RM26085, which were polymorphic between the parents between RM1812 and RM26092, were screened, and these 5 pairs of primers were used to analyze the mutant individuals in 1008 F2 populations, and the obtained information was used to construct a physical map. Finally, the mutated gene was finely ma...

Embodiment 3

[0032] Example 3: Gene prediction and sequence comparison analysis

[0033] According to the results of fine mapping, 8 predicted genes in this interval were analyzed, and a gene cpSRP54 encoding chloroplast signal recognition granule protein was found. Sequencing found that the last base in the first intron of the gene in the mutant HM14 was mutated, which may affect the normal splicing, so the gene was designated as a candidate gene and named OscpSRP54.

[0034] Utilizing RT-PCR technology, using primer pair SEQ ID No.3 (TCGCTCATCGGCAATGGA) and SEQ ID No.4 (TTCCACGGCATTCTTGGTTATT) to amplify cDNA, compare the fragment size of OscpSRP54 gene in wild type and mutant HM14, the experiment confirmed that the base The base mutation caused the retention of the first intron in the mutant, and its amplified fragment was 119bp larger than the normally spliced ​​wild type (such as Figure 5 shown).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a cDNA sequence represented by the SEQ ID No.1 of a paddy rice leaf color control gene OscpSRP54 coding area and an amino acid sequence represented by SEQ ID No.2 of a protein encoded by the gene. The gene OscpSRP54 which controls the paddy rice leaf color is cloned from a paddy rice light green leaf mutant HM14 through a map-based cloning technology, and the gene OscpSRP54 is proved to be the gene that control the paddy rice leaf color through a functional complementation experiment. Through observation of chloroplast by using a transmission electron microscope, the fact that the OscpSRP54 gene has the function of modulating chloroplast growth and then further controlling the leaf color is proved. The OscpSRP54 gene can be used to modulate paddy rice chloroplast growth so as to improve the photosynthesis efficiency and increase the paddy rice output. The leaf color control gene provided by the invention can also be used as a tracing marker in a genetic transferred plant progeny or an indicating marker for distinguishing pure species from hybrid species in a hybrid seed production process, and can be applied to the fields of good species breeding and hybrid breeding.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering, and in particular relates to a rice OscpSRP54 gene cloned by map-based cloning technology, which can be used to regulate rice chloroplast development, improve photosynthesis efficiency, and increase rice yield. The leaf color control gene of the present invention can also be used as a tracking marker for the progeny of the transformed plant and an indicator marker for true hybrids in the hybrid seed production process. Background technique [0002] Rice is an important food crop in the world and in my country. There are 3.5 billion people in the world, and more than 60% of the population in my country takes rice as a staple food. In order to ensure food security, my country launched the super rice development plan in 1996. Leaf photosynthesis efficiency is an important factor that determines the yield of rice, and the high efficiency of photosynthesis depends on the synthesis of chloroph...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/415C12N15/29C12N15/84C12N1/21C12N5/10A01H5/00
CPCC07K14/415C12N15/8218
Inventor施勇烽吴建利王惠梅徐霞张晓波
OwnerCHINA NAT RICE RES INST