Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for using polypeptide-mediated DNA nanostructure as antitumor drug carrier

A technology of anti-tumor drugs and nanostructures, applied in anti-tumor drugs, drug combinations, pharmaceutical formulations, etc., can solve the biosafety disputes of metal nanoparticles, affect the efficiency of carriers entering cells, etc., and achieve the effect of improving loading efficiency

Inactive Publication Date: 2014-03-26
SHANGHAI NAT ENG RES CENT FORNANOTECH
View PDF1 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, in the anti-tumor research of using nanoparticles or nanostructures as anti-tumor drug carriers, polymer nanomaterials, liposomes and metal nanoparticles are used more, and there are many precedents of successful application of nano-drug delivery systems. , but it is undeniable that there are still many problems in the research of high-efficiency drug loading, targeted delivery, and multifunctional drug carriers integrating treatment and detection. For example, the particle size distribution of liposomes may affect the carrier’s entry The efficiency of cells, and some other metal nanoparticles have biosafety controversies, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for using polypeptide-mediated DNA nanostructure as antitumor drug carrier

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Add 12 μL of circular DNA (2 μM, sequence: 5'TATGCCCAGCCCTGTAAGATGAAGATAGCGCACAATGGTCGGATTCTCAACTCGTATTCTCAACTCGTATTCTCAACTCGTCCTGCCCTμL, 10 mM) to 16 μL primer DNA (1 μM, sequence: 5'CCAGCCTAAGAGTTGAGCA3'), dNTPs (4 μL, 10 mM), RCA buffer polymerase 4μL, 10 U / μL), the final volume of the mixed solution was 40μL. Then 30°C, amplified in a water bath for 30min. 40 μL of the obtained product was subjected to 10% PAGE electrophoresis, and then recovered by slicing gel to remove small fragments of DNA, redundant circular DNA and primer DNA. Take 3 μL of the recovered product, add 12 μL of milliQ water, and add stapled strands 1-3 (100 μM, the sequence is as follows:

[0026] 5'-CAGCCCTGTAAGATGAAGATAGCGTCTATGCC-3'

[0027] 5'-CCCTGACTCACAATGGTCGGATTCCGTCTCTG-3'

[0028] 5’-TCTCAACTTCAACTCGTATTCTCAACTCGTAT-3’) 1 μL each, 2 μL TAE buffer (10×, 125 mM Mg 2+ ), the total volume was 20 μL, the solution was mixed well and placed in a high temperature of 95 °C, and then the tem...

Embodiment 2

[0030] Add 12 μL of circular DNA (2 μM, sequence: 5'TATGCCCAGCCCTGTAAGATGAAGATAGCGCACAATGGTCGGATTCTCAACTCGTATTCTCAACTCGTATTCTCAACTCGTCCTGCCCTμL, 10 mM) to 16 μL primer DNA (1 μM, sequence: 5'CCAGCCTAAGAGTTGAGCA3'), dNTPs (4 μL, 10 mM), RCA buffer polymerase 4μL, 10 U / μL), the final volume of the mixed solution was 40μL. Then it was amplified in a water bath at 30°C for 30 min. 40 μL of the obtained product was subjected to 10% PAGE electrophoresis, and then recovered by slicing gel to remove small fragments of DNA, redundant circular DNA and primer DNA. Take 3 μL of the recovered product, add 12 μL of milliQ water, and add stapled strands 1-3 (100 μM, the sequence is as follows:

[0031] 5'CAGCCCTGTAAGATGAAGATAGCGTCTATGCC3'

[0032] 5'CCCTGACTCACAATGGTCGGATTCCGTCTCTG3'

[0033] 5'TCTCAACTTCAACTCGTATTTCTCAACTCGTAT3', where the 5' of staple 2 is biotin-modified) 1 μL each, 2 μL TAE buffer (10×, 125 mM Mg 2+ ), the total volume was 20 μL, the solution was mixed well and place...

Embodiment 3

[0035]Add 12 μL of circular DNA (2 μM, sequence: 5'TATGCCCAGCCCTGTAAGATGAAGATAGCGCACAATGGTCGGATTCTCAACTCGTATTCTCAACTCGTATTCTCAACTCGTCCTGCCCTμL, 10 mM) to 16 μL primer DNA (1 μM, sequence: 5'CCAGCCTAAGAGTTGAGCA3'), dNTPs (4 μL, 10 mM), RCA buffer polymerase 4μL, 10 U / μL), the final volume of the mixed solution was 40μL. Then it was amplified in a water bath at 30°C for 30 min. 40 μL of the obtained product was subjected to 10% PAGE electrophoresis, and then recovered by slicing gel to remove small fragments of DNA, redundant circular DNA and primer DNA. Take 3 μL of the recovered product, add 12 μL of milliQ water, and add stapled strands 1-3 (100 μM, the sequence is as follows:

[0036] 5'CAGCCCTGTAAGATGAAGATAGCGTCTATGCC3'

[0037] 5'CCCTGACTCACAATGGTCGGATTCCGTCTCTG3'

[0038] 5'TCTCAACTTCAACTCGTATTTCTCAACTCGTAT3', where the 5' of staple 2 is biotin-modified) 1 μL each, 2 μL TAE buffer (10×, 125 mM Mg 2+ ), the total volume was 20 μL, the solution was mixed well and placed...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for using a polypeptide-mediated DNA nanostructure as an antitumor drug carrier. The method is characterized in that a polypeptide with certain functions is connected to a DNA nanostructure; the prepared product is the combination of the DNA nanostructure and the polypeptide. After biomolecules are loaded to the surface of the DNA nanostructure and when the DNA nanostructure interacts with a cell, the polypeptide with the certain functions can mediate the DNA nanostructure loaded with the biomolecules to enter the cell or specifically be combined with a receptor on one surface of the cell so as to achieve the purpose of using the DNA nanostructure as the antitumor drug carrier. The method has a potential application value in the aspects of developing and researching the antitumor drug carrier, and improving the loading efficiency of the antitumor drug carrier.

Description

technical field [0001] The invention belongs to the field of functionalization and application of nanomaterials, and relates to a technique in which DNA nanostructures can efficiently load loaded biomolecules into cells through the mediation of polypeptides; the constructed biocomposite structure can be used for the development of new high-efficiency anti-tumor drug carriers and research. Background technique [0002] Cancer has surpassed cardiovascular and cerebrovascular diseases and has become the number one enemy that endangers human life. With the increasing incidence of tumors, people's research on cancer diagnosis and treatment is also deepening. Some consensus has been formed, including: for a variety of malignant tumor tissues and cells, accurate and reliable early diagnosis is difficult; current anticancer drugs have serious side effects due to biocompatibility problems; Application of cancer drugs, etc. Therefore, how to realize the specific entry of diagnostic...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K47/42A61K47/26A61P35/00
Inventor 颜娟宋世平樊春海金彩虹何丹农
Owner SHANGHAI NAT ENG RES CENT FORNANOTECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com