Preparation method and application of kit for double-sandwich immunofluorescence quantitative detection of human anti-Mullerian hormone (AMH) on basis of quantum dots

An immunofluorescence and quantitative detection technology, which is applied in the field of immunodiagnosis, can solve the problems of ineffective clinical promotion, many influencing factors, and not widely deployed, and achieve effective detection and risk assessment, improve resolution, and provide the effect of resolution

Inactive Publication Date: 2014-04-16
李志荣
View PDF3 Cites 17 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Some domestic diagnosis and treatment institutions have introduced the kit and conducted relevant clinical tests, but its price is relatively expensive and cannot be effectively promoted clinically
At present, there is no registered kit supply using quantum dot immunoassay method to detect AMH in China, and t

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method and application of kit for double-sandwich immunofluorescence quantitative detection of human anti-Mullerian hormone (AMH) on basis of quantum dots
  • Preparation method and application of kit for double-sandwich immunofluorescence quantitative detection of human anti-Mullerian hormone (AMH) on basis of quantum dots
  • Preparation method and application of kit for double-sandwich immunofluorescence quantitative detection of human anti-Mullerian hormone (AMH) on basis of quantum dots

Examples

Experimental program
Comparison scheme
Effect test

Example Embodiment

[0021] The present invention will be further described below in conjunction with embodiments, but it is not limited thereto.

[0022] 1) Construction of AMH prokaryotic expression vector

[0023] The immunogenic region of AMH was selected. The gene sequence is shown in SEQ ID NO. 2, with a total of 297 bp, and the corresponding amino acid sequence is shown in SEQ ID NO. 1, with a total of 93 amino acids.

[0024] The specific primers designed to amplify the sequence of the AMH immunogen region are as follows:

[0025] EcoR I Up primer: CCG GAATTC AGCGTAGACCTCCGCGCCGC (the underlined part is the recognition sequence of the endonuclease EcoR I) (SEQ ID NO.3),

[0026] Xho I Down primer: CCG CTCGAG CCGGCAGCCACACTCGGTGG (the underlined part is the recognition sequence of endonuclease Xho I) (SEQ ID NO. 4).

[0027] The total RNA of human ovarian cancer cells was extracted by chloroform, and the AMH immunogenic sequence was amplified by reverse transcription and PCR primers. The amplified A...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a kit for double-sandwich immunofluorescence quantitative detection of human anti-Mullerian hormone (AMH) on the basis of quantum dots and application thereof. The original kit contains an AMH protein standard substance, an ELISA plate coated with an AMH specific polyclonal antibody and a CdTe quantum dot labeled AMH monoclonal antibody. The detection antibody used in the kit is a CdTe quantum dot label for monoclonal antibodies, and can better remove background signals; the detection method is simple and convenient, and has high practicality; the detection result directly determined by a fluorescent ELIASA indicates that the emitted fluorescence has the advantages of narrow spectrum peak, weak autofluorescence and high sensitivity; the kit has the advantages of high fluorescence intensity and long stabilization time, and overcomes the actual states of low sensitivity and poor specificity in the traditional ELISA detection kit; and the kit can enhance the resolution, sensitivity and specificity of ovary reservation function detection.

Description

technical field [0001] The invention belongs to the technical field of immunodiagnosis and relates to quantum dot-based immunofluorescence quantitative detection, in particular to a quantum dot-based double-sandwich immunofluorescence quantitative detection kit for human anti-Müllerian hormone (AMH) and its preparation and application . Background technique [0002] At present, clinical evaluation of ovarian function in various domestic clinics is mainly based on age, the number of antral follicles (Antral follicle count), follicle stimulating hormone (FSH) and estrogen (E2) levels, etc. However, the above-mentioned traditional methods are prone to errors due to the influence of various factors, and at the same time, they are prone to result bias due to the subjective judgment of the tester; in addition, the detection of the above indicators is restricted by the time limit of the menstrual cycle, and the detection value is affected by the fluctuation of the menstrual cycle. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): G01N33/74G01N21/64
CPCG01N33/74G01N2800/36
Inventor 夏曦管亚楚
Owner 李志荣
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap