Supercharge Your Innovation With Domain-Expert AI Agents!

A Mortierella alpina genetic engineering strain overexpressing ω3 desaturase gene and its construction method

A genetically engineered strain, Mortierella alpina technology, applied in the field of bioengineering, can solve the problems of insufficient activity, low EPA production, and low expression

Active Publication Date: 2017-02-08
JIANGNAN UNIV
View PDF3 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The main reason for the low production of EPA in Mortierella alpina may be due to the low expression or insufficient activity of its own ω3 Des

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A Mortierella alpina genetic engineering strain overexpressing ω3 desaturase gene and its construction method
  • A Mortierella alpina genetic engineering strain overexpressing ω3 desaturase gene and its construction method
  • A Mortierella alpina genetic engineering strain overexpressing ω3 desaturase gene and its construction method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1: Cloning of the Mortierella alpina ω3 desaturase gene (FADS15)

[0040] According to the sequence information of the Mortierella alpina ω3 desaturase gene (FADS15), primers P1 and P2 were designed, and the underlined parts are the restriction sites NheI and SacI, respectively, for the plasmid pET19b-FADS15 containing the ω3 desaturase gene (FADS15) as a template (this lab has published articles Haiqin Chen, Zhennan Gu, Hao Zhang, Mingxuan Wang, WeiChen, W.Todd Lowther, Yong Q.Chen*.Expression and Purification of Integral Membrane Fatty Acid Desaturases.PLoS ONE.2013,8( 3): e58139), using primers P1 / P2 and KOD high-fidelity polymerase to amplify the ω3 desaturase gene (FADS15) by PCR to obtain a fragment. The PCR program was: 94°C for 30s, 55°C for 30s, 68°C for 1.5min, 30 cycles, and the PCR product was purified, and the purified product was verified by 1.2% agarose gel electrophoresis.

[0041] P1 (sense): GCCATA GCTAGC AAATGGCACCCCCTCACGTTGT

[0042] P2 ...

Embodiment 2

[0044] Embodiment 2: Construction of binary expression vector

[0045] 1. Enzyme digestion reaction

[0046] Under the condition of 37°C, the restriction endonuclease NheI was first digested overnight, the product ω3 desaturase gene fragment FADS15 and the vector pBIG2-ura5s-ITs fragment were purified by PCR, and the gel was recovered. The NheI digestion system (100 μL) is: 2 μL NheI-HF, 1 μL BSA, 30 μL plasmid or PCR product, 10 μL Buffer4 (purchased from NEB Company, Cat. No. B7004S), 57 μL deionized water, digested in a water bath at 37°C for 5 hours.

[0047] The digested product was recovered and digested with SacI. The enzyme digestion system was (100 μL): 2 μL SacI, 30 μL plasmid or PCR product, 10 μL Buffer4 (purchased from NEB Company, Cat. No. B7004S), 58 μL deionized water, digested in a 37°C water bath 5h.

[0048] 2. Ligation reaction

[0049] The digested ω3 desaturase gene fragment FADS15 was ligated with the vector pBIG2-ura5s-ITs with T4 ligase, and ligated...

Embodiment 3

[0058] Example 3: Agrobacterium tumefaciens-mediated transformation of MAU1 (CCFM501)

[0059] On the basis of the existing domestic and foreign literature reports on the transformation method of Agrobacterium tumefaciens, appropriate optimization and adjustments have been made. The specific successful implementation examples are as follows:

[0060] (1) Agrobacterium tumefaciens C58C1 containing the plasmid pBIG2-ura5s-FADS15 stored at -80°C was streaked on a YEP solid medium plate containing 100 μg / mL rifampicin and 100 μg / mL kanamycin. Incubate in the dark at 30°C for 48 hours.

[0061] (2) Pick a single clone and inoculate it into 20 mL of MM liquid medium containing 100 μg / mL rifampicin and 100 μg / mL kanamycin at 30°C, 200 rpm, and incubate in the dark for 24-48 hours.

[0062] (3) Centrifuge at 4000g for 5 minutes to collect the bacteria, and discard the supernatant. Add 5mL IM liquid medium to resuspend the bacteria, centrifuge at 4000g for 5 minutes, and discard the ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a mortierella alpina, M. alpina genetic engineering strain of an overexpression omega 3 desaturase gene (FADS15) and a construction method of the strain. According to the invention, a mortierella alpina, M. alpina uracil nutritional-deficient strain MAU1 (CCFM501) is taken as a material, an agrobacterium tumefaciens-mediated genetic manipulation technology is applied to obtain an omega 3 desaturase (omega 3Des) overexpression strain of high-yield EPA (eicosapentaenoic acid), and the strain and the construction method have important significance on basic theoretical research and product development of mortierella alpina, M. alpine as an oil-producing fungus.

Description

technical field [0001] The invention relates to a Mortierella alpina genetically engineered strain overexpressing an ω3 desaturase gene (FADS15) and a construction method thereof, belonging to the technical field of bioengineering. Background technique [0002] Polyunsaturated fatty acids (PUFAs) refer to straight-chain fatty acids with two or more double bonds and 16-26 carbon atoms. Among them, omega-3 series PUFAs and omega-6 series PUFAs are essential fatty acids for the human body, which cannot be synthesized in the body and can only be ingested through food. Those belonging to the omega-3 series are: ALA (α-linolenic acid, 18:3), EPA (eicosapentaenoic acid, 20:5) and DHA (docosahexaenoic acid, 22:6), etc.; Those belonging to the omega-6 series are: LA (linoleic acid, 18:2), GLA (γ-linolenic acid, 18:3) and ARA (arachidonic acid, 20:4). In current people's dietary fats, the ratio of omega-6 / omega-3 exceeds 10:1, which is much higher than the optimal ratio required by ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/15C12N15/53C12N15/63C12P7/64C12R1/645
Inventor 陈永泉陈卫陈海琴黄小云顾震南赵建新张灏杨芹王鸿超
Owner JIANGNAN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More