Schizochytrium limacinum strain as well as building method and application thereof
A technology of Schizochytrium and construction methods, applied in the direction of microorganism-based methods, biochemical equipment and methods, fungi, etc., can solve the problems of unfavorable DHA accumulation and unfavorable cell growth, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Embodiment 1 This embodiment illustrates the biological material source information of the present invention
[0036] Schizochytrium sp. HX-308 has been preserved in China Center for Type Culture Collection (CCTCC), and its preservation number is CCTCC No: M 209059.
[0037] The domesticated Schizochytrium sp.HX-RS genetically engineered strain is preserved in the China Center for Type Culture Collection, and its preservation number is CCTCC No: M2017046.
[0038] Carrier PBS-Zeo: self-constructed by our laboratory.
[0039] Vector PMD19-T (simple): commercial vector, purchased from TaKaRa Company.
Embodiment 2
[0040] Example 2 This example illustrates the construction of the recombinant plasmid PBS-Zeo-AT for AT functional domain knockout
[0041] The construction steps of plasmid PBS-Zeo-AT are as follows: figure 1 shown.
[0042] 1. Obtain the upper and lower homology arms of the Schizochytrium AT gene
[0043] (1) Obtain the upstream homology arm of the Schizochytrium AT gene
[0044] According to the AT gene sequence obtained by sequencing, primers ATup-S and ATup-A were designed to amplify the upstream homology arm of Schizochytrium sp.HX-308 and ligated to the PMD19-T vector to obtain a recombinant plasmid pMD19-ATup. in,
[0045] ATup-S sequence:
[0046] 5'AAGGAAAAAAGCGGCCGCTGCTATTCCGTGCTCCTCTC 3',
[0047] ATup-A sequence:
[0048] 5' GCTCTAGAGCGCCTTGGGCGTGATGTTGAG 3'.
[0049] (2) Obtain the downstream homology arm of Schizochytrium AT gene
[0050] Primers ATdown-S and ATdown-A were designed according to the obtained AT sequence of Schizochytrium to amplify the d...
Embodiment 3
[0059] Example 3 This example illustrates the oil production of acyltransferase AT-deficient Schizochytrium strains
[0060] The plasmid PBS-Zeo-AT was double-digested with NotI and KpnI restriction enzymes, and then the fragments containing the upstream and downstream homology arms of AT and bleomycin were purified using the Takara gel recovery kit, and transformed into In Schizochytrium, spread the transformed bacterial solution on a plate containing 20 μg / mL bleomycin, culture at 30°C in the dark for 2 days, pick a positive single colony for shake flask culture, and extract the genome for PCR verification. And the correct defective strain was named Schizochytriumsp.HX-DS.
[0061] The engineered bacteria obtained above were inoculated into the seed medium under the following culture conditions: temperature 30° C., rotation speed 170 rpm, and cell dry weight and fatty acid content were measured respectively. Compared with the parameters of the original strain under the same...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



