Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Identification and application of plant anther specific expression promoter

An anther-specific and promoter technology, applied to isolated DNA, the application field of this DNA can solve the problems of gene silencing with high promoter sequence homology, long waiting time, etc., and achieve the effect of avoiding biosafety problems

Active Publication Date: 2014-05-28
SHENZHEN INST OF MOLECULAR CROP DESIGN +1
View PDF7 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] In addition, when studying certain metabolic processes or regulatory pathways, it is often necessary to transform two or more genes on the same pathway into the same line, transforming one of the genes to obtain a transgenic plant and then transforming another gene, or It takes a long time to wait for the hybridization after the two genes have been transformed separately. In order to improve the efficiency and shorten the time for transforming multiple genes, it has recently been reported that a new vector can be used to transform multiple genes at the same time, but in multi-gene If the same promoter is used repeatedly during transformation, gene silencing may also occur due to the high homology of the promoter sequence

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Identification and application of plant anther specific expression promoter
  • Identification and application of plant anther specific expression promoter
  • Identification and application of plant anther specific expression promoter

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Example 1. Real-time PCR expression analysis of OSJFL2 gene in rice

[0033] In the research, the inventor accidentally found that the rice OSJFL2 gene was only expressed in the P6 phase of the flower, and Realtime-PCR expression analysis was performed on different stages of the flower. The roots, stems, leaves, seeds and young panicles of P3, P6 and P8 stages of rice plants were taken, RNA was extracted, reverse-transcribed into cDNA as a template, and rice ACTIN gene was used as an internal reference to analyze the expression of OSJFL2 gene in rice. Express the situation. The P3 stage in the present invention refers to the differentiation stage of the spikelet primordia, the P6 stage refers to the pollen meiosis stage, and the P8 stage refers to the pollen maturation stage.

[0034] The detection primers for RT-PCR are:

[0035] Primer 1: 5'-CCAACTTCCCCGTCAACCT-3' (SEQ ID NO: 2);

[0036] Primer 2: 5'-TGGTAGTGCCAGATGGTCATG-3' (SEQ ID NO: 3);

[0037] Primer 3: 5'-...

Embodiment 2

[0044] Example 2. Isolation and identification of the promoter pOSJFL2

[0045] Design the primers required for cloning the promoter pOSJFL2 as follows:

[0046] Primer 5: 5'-CGggatcc TTCTGACCAAAAGAAGGGCG -3' (SEQ ID NO: 6);

[0047] Primer 6: 5'-Ggtcgac TTTCGCCGGGCAAATTC -3' (SEQ ID NO: 7);

[0048] The sequence ggatcc in primer 5 is the restriction site of BamHI, and the sequence gtcgac in primer 6 is the restriction site of SalI.

[0049]Using the forward and reverse primers of the promoter (the sequence with the underlined part is the promoter sequence), the genomic DNA of rice (Nipponbare) extracted from the plant genomic DNA extraction kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.) was used as a template, For amplification, the reaction conditions were: pre-denaturation at 95°C for 5 minutes; denaturation at 94°C for 30 seconds; annealing at 55°C for 30 seconds; extension at 72°C for 2:30 minutes; 30 cycles; extension at 72°C for 10 minutes. After the re...

Embodiment 3

[0050] Example 3. Construction of expression vectors

[0051] The pEASY-T1 plasmid that has been inserted into the pOSJFL2 promoter sequence verified by sequencing was digested with BamHI and SalI, and connected to the vector pHPG that was also digested with BamHI and SalI, and the colonies were picked for PCR detection, and the PCR results were positive. The colonies were sequenced, and after the sequence verification was correct, the corresponding positive clone plasmid was extracted and named pHPG-pOSJFL2. Among them, the primers required for colony PCR detection are the primers on the pHPG carrier, located on both sides of the cloned promoter fragment, the amplified fragment is about the length of the promoter, and the bacterial liquid is used as a template for amplification detection. The PCR reaction conditions are: 95 Pre-denaturation at ℃ for 5 minutes; denaturation at 94°C for 30 seconds; annealing at 55°C for 30 seconds; extension at 72°C for 2: 30 minutes; 34 cycles...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of plant biology and particularly relates to separation, function identification and application of a rice anther specific expression promoter. The disclosed promoter is specifically expressed in a plant anther and has good application prospects in the field of plant genetic modification.

Description

technical field [0001] The present invention belongs to the field of plant biotechnology, in particular, the present invention relates to isolated DNA, which can direct the specific transcription and / or expression of nucleic acid operably linked downstream of it in plant anthers. In addition, the present invention also relates to expression cassettes and plants containing the DNA, and to applications of the DNA. Background technique [0002] The exogenous DNA sequence is linked to a specific promoter to promote expression in the plant host, and the choice of the promoter type determines the time and location of gene expression. At present, some constitutive strong promoters are widely used in the field of agricultural biotechnology, such as the CaMV35S promoter and the corn Ubiquitin-1 promoter. , the improvement effect is often not obvious because the time (developmental stage-specific) or space (tissue-organ-specific) of the expression of the target gene cannot be well co...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/84C12N1/21A01H5/00
Inventor 唐晓艳邓兴旺陈竹锋
Owner SHENZHEN INST OF MOLECULAR CROP DESIGN
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com