Identification and application of plant anther specific expression promoter
An anther-specific and promoter technology, applied to isolated DNA, the application field of this DNA can solve the problems of gene silencing with high promoter sequence homology, long waiting time, etc., and achieve the effect of avoiding biosafety problems
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] Example 1. Real-time PCR expression analysis of OSJFL2 gene in rice
[0033] In the research, the inventor accidentally found that the rice OSJFL2 gene was only expressed in the P6 phase of the flower, and Realtime-PCR expression analysis was performed on different stages of the flower. The roots, stems, leaves, seeds and young panicles of P3, P6 and P8 stages of rice plants were taken, RNA was extracted, reverse-transcribed into cDNA as a template, and rice ACTIN gene was used as an internal reference to analyze the expression of OSJFL2 gene in rice. Express the situation. The P3 stage in the present invention refers to the differentiation stage of the spikelet primordia, the P6 stage refers to the pollen meiosis stage, and the P8 stage refers to the pollen maturation stage.
[0034] The detection primers for RT-PCR are:
[0035] Primer 1: 5'-CCAACTTCCCCGTCAACCT-3' (SEQ ID NO: 2);
[0036] Primer 2: 5'-TGGTAGTGCCAGATGGTCATG-3' (SEQ ID NO: 3);
[0037] Primer 3: 5'-...
Embodiment 2
[0044] Example 2. Isolation and identification of the promoter pOSJFL2
[0045] Design the primers required for cloning the promoter pOSJFL2 as follows:
[0046] Primer 5: 5'-CGggatcc TTCTGACCAAAAGAAGGGCG -3' (SEQ ID NO: 6);
[0047] Primer 6: 5'-Ggtcgac TTTCGCCGGGCAAATTC -3' (SEQ ID NO: 7);
[0048] The sequence ggatcc in primer 5 is the restriction site of BamHI, and the sequence gtcgac in primer 6 is the restriction site of SalI.
[0049]Using the forward and reverse primers of the promoter (the sequence with the underlined part is the promoter sequence), the genomic DNA of rice (Nipponbare) extracted from the plant genomic DNA extraction kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.) was used as a template, For amplification, the reaction conditions were: pre-denaturation at 95°C for 5 minutes; denaturation at 94°C for 30 seconds; annealing at 55°C for 30 seconds; extension at 72°C for 2:30 minutes; 30 cycles; extension at 72°C for 10 minutes. After the re...
Embodiment 3
[0050] Example 3. Construction of expression vectors
[0051] The pEASY-T1 plasmid that has been inserted into the pOSJFL2 promoter sequence verified by sequencing was digested with BamHI and SalI, and connected to the vector pHPG that was also digested with BamHI and SalI, and the colonies were picked for PCR detection, and the PCR results were positive. The colonies were sequenced, and after the sequence verification was correct, the corresponding positive clone plasmid was extracted and named pHPG-pOSJFL2. Among them, the primers required for colony PCR detection are the primers on the pHPG carrier, located on both sides of the cloned promoter fragment, the amplified fragment is about the length of the promoter, and the bacterial liquid is used as a template for amplification detection. The PCR reaction conditions are: 95 Pre-denaturation at ℃ for 5 minutes; denaturation at 94°C for 30 seconds; annealing at 55°C for 30 seconds; extension at 72°C for 2: 30 minutes; 34 cycles...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com