Unlock instant, AI-driven research and patent intelligence for your innovation.

Brown planthopper gene Nl1860 as well as encoding product and application thereof

A technology for brown planthoppers and transgenic plants, which is applied in the fields of application, genetic engineering, plant gene improvement, etc. It can solve the problems of reducing related genes, not cloning brown planthoppers, and the lethal effect of brown planthoppers is not obvious, so as to achieve good insect resistance effect

Inactive Publication Date: 2014-05-28
ZHEJIANG UNIV
View PDF2 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the use of these transgenic rice lines can reduce the transcription level of related genes to a certain extent, the lethal effect on BPH is not obvious
Therefore, so far, no relevant target gene of brown planthopper has been cloned at home and abroad, and the purpose of controlling brown planthopper can be achieved by silencing the gene through transgenic rice

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Brown planthopper gene Nl1860 as well as encoding product and application thereof
  • Brown planthopper gene Nl1860 as well as encoding product and application thereof
  • Brown planthopper gene Nl1860 as well as encoding product and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Embodiment 1, Nl1860 Gene acquisition and sequence analysis

[0033] 1) Extraction, quality inspection and first-strand synthesis of total cDNA from salivary gland RNA of brown planthopper;

[0034] 2) Synthesized by polymerase chain reaction (PCR) from the first strand of total cDNA Nl1860 CDS Fragment

[0035] Upstream primer (SEQ ID NO.3): 5'- TGTAGGAATTGAGCAGCAAG -3'

[0036] Downstream primer (SEQ ID NO.4): 5'- ATAAATTCTTTGGTGCATCC -3'

[0037] PCR amplification conditions: 94°C×3min→(94°C×30sec→55°C×30sec→72°C×1min30sec)×30 cycles→72°C×10min, to obtain specific PCR amplification products see appendix figure 1 .

[0038] 3) pMD19- Nl1860 Cloning vector construction and gene base analysis

[0039] The PCR product was cloned into the pMD19-T vector of Takara Company to obtain pMD19- Nl1860 carrier, and through CaCl 2 Transformed into TG1 Escherichia coli, containing pMD19- Nl1860 The carrier TG1 bacterial liquid was sent to Nanjing GenScript Company for s...

Embodiment 2

[0040] Embodiment 2, brown planthopper Nl1860 dsRNA synthesis and injection RNAi effect

[0041] 1) From the above pMD19- Nl1860 Obtained by polymerase chain reaction (PCR) in the cloning vector Nl1860 The middle 215bp fragment, and continue to synthesize Nl1860 dsRNA fragments. At the same time with GFP Plasmid as template, obtained by PCR GFP The middle 860bp fragment, and continue to synthesize GFP dsRNA fragment

[0042] ds Nl1860 -T7-F (SEQ ID NO.5):

[0043] 5’- GGATCCTAATACGACTCACTATAGGGCACGCTAAGCAACTCTT-3’

[0044] ds Nl1860 -T7-R (SEQ ID NO.6):

[0045] 5’-GGATCCTAATACGACTCACTATAGGACTCGTTCGGTCTGTCCT-3’

[0046] ds GFP -T7-F (SEQ ID NO. 7):

[0047]5'-GGATCCTAATACGACTCACTATAGGAAGGGCGAGGAGCTGTTCACCG-3'

[0048] ds GFP- T7-R (SEQ ID NO.8):

[0049] 5'-GGATCCTAATACGACTCACTATAGGCAGCAGGACCATGTGATCGCGC-3'

[0050] PCR amplification conditions:

[0051] Nl1860 : 94℃×3min→(94℃×30sec→62℃×30sec→72℃×30sec)×30 cycles→72℃×10min

[0052] GFP : 94℃×3min...

Embodiment 3

[0067] Embodiment 3, transgene Nl1860 Studies on the function of dsRNA against insects in rice

[0068] 1. Design forward and reverse primers, PCR amplify the 215bp long 625th to 839th Nl1860 genetic DNA fragment.

[0069] 2. DNA subcloning Nl1860 The gene fragment is inserted into the pMECE vector forward and reverse at the same time, and the forward and reverse connections are obtained. Nl1860 Gene fragment RNAi expression vector pMECE- Nl1860 ( Figure 6 ).

[0070] 3. Add pMECE- Nl1860 , into Agrobacterium EHA105 by electric shock method to obtain Agrobacterium engineered cell line. The rice callus was infected by Agrobacterium transfection method, and the co-infected rice callus was cultured on NBDS medium containing hygromycin, and the first selection was 20 days. After the new resistant callus grows, the resistant callus is stripped from the parent body and transferred to a new selection medium NBDS2, and one resistant callus is a strain. After the resistant c...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a brown planthopper gene Nl1860 as well as an encoding product and application thereof. The gene Nl1860 has the DNA sequence shown in SEQ ID No. 1. The DNA sequence is composed of 1454 nucleotide bases and contains a complete encoding frame composed of 1386 nucleotides, and the coded proteins contain a protein containing 461 amino acid residues. Research finds that the gene is related to the feeding, survival and egg laying amount of brown planthopper. An RNAi vector for the Nl1860 is constructed and then is transferred into rice to express dsRNA of the gene Nl1860 in the transgenic rice body, so as to achieve the purpose of improving the resistance to brown planthopper of rice. The brown planthopper gene Nl1860 can be widely applied to crop breeding, particularly breeding of insect-resistant rice.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a brown planthopper gene Nl1860 And its coding products and applications. Background technique [0002] Rice ( Oryza sativa L.) is one of the most important food crops in China and even in the world. In China, the annual rice planting area is about 30 million hectares 2 , accounting for nearly 1 / 2 of the planting area of ​​grain crops, and rice production accounts for 45% of the total grain output. In recent years, China's rice planting area has declined, but rice production still accounts for about 40% of the total grain output. Rice production is directly related to China's food security. However, the annual loss of rice production due to rice plant diseases and insect pests in the whole country is huge, although the control still causes economic losses of 4 million to 5 million tons, and even the grains are not harvested in severe disaster years. Therefore, how to increase f...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/12C07K14/435A01H5/00
Inventor 娄永根纪锐陈红丹李恒叶文丰禹海鑫
Owner ZHEJIANG UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More