Check patentability & draft patents in minutes with Patsnap Eureka AI!

Method for improving plant traits

A plant trait and plant technology, applied in the fields of genetic engineering and botany, can solve the problems of immature forest tree genetic transformation technology, short development time, and restrictions on the development of forest tree genetic engineering breeding

Inactive Publication Date: 2014-06-18
SHANGHAI INST OF BIOLOGICAL SCI CHINESE ACAD OF SCI
View PDF1 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, because the research work on biotechnology breeding has not been carried out for a long time, the genetic transformation technology of forest trees is relatively immature, and the genes that can be really applied to forest tree breeding are still very limited, which limits the development of forest tree genetic engineering breeding

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for improving plant traits
  • Method for improving plant traits
  • Method for improving plant traits

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0139] Embodiment 1, the establishment of transgenic poplar

[0140] The OsCYP714D1 gene sequence derived from rice is as follows (SEQ ID NO: 1):

[0141] ATGGAGAGCTTCTTCGTCTTCTTCACGGCGGCGGCGTTGCCGGTGGTGGTGGCGGCGGCGGTGATCGCCGGGCTGTGCATTACGGCGGCGTG

[0142] GCTGGCGAGGCCGCGGCGCGTGGCGGAGGTGTTCCGGAGGCAGGGGATCGACGGCCCGCCGCCGTCGTCGTTCCTGGCGGGGAACCTCCCGG

[0143] AGATGAAGGCGAGGGTGGCCGCCGCGGCGTCGGCGGCGGCGCCAACGGCGGACGGGGAGGAGACCGCCTCCGCCGGCGGCGGCGGCGGTGGC

[0144] CGGGACTTCGAGAAGGACGGGTTCGACGACTACTGCACCAGGATCTTCCCTACTTCCACAAGTGGAGGAAAGCCTACGGCGAGACGTACCT

[0145] GTACTGGCTGCGGCGGCGGCCGGCGCTGTACGTGACGGACCCGGAGCTCATCGGCGAGATCGGGCGGTGCGTGTCGCTCGACATGGGCAAGC

[0146] CCAAGTACCTCCAGAAAGGCCAGGAGCCACTCTTCGGCGGCGGCGTCCTCAAGGCCAACGGCGCGTGCTGGGCGCGCCAGCGCAAGGTCATC

[0147] GCGCCGGAGTTCTACATGGCCCGTGTCAGGGCCATGGTCCAGCTCATGGTCGACGCCGCGCAGCCGCTGATCGCCTCCTGGGAATCCAGGAT

[0148] CGACGCCGCTGGAGGCGCGGCGGCGGCGGAGGTCGTCGTCGACGGCGACCTCCGGAGCTTCTCCTTCGATGTGATATCGCGGGCTTGCTTTG

[0149] GGAGTGATTACTCGA...

Embodiment 2

[0168] Embodiment 2, the phenotypic analysis of transgenic poplar

[0169] Transgenic poplars and wild-type poplars at the same growth period were transplanted into the soil, cultivated under the conditions of artificial climate chamber (temperature 22-25°C, light 12 hours / day, light intensity 6000 lux) and observed the phenotype. At the same time, a transgenic line (L23) that did not overexpress the OsCYP714D1 gene was used as a negative control.

[0170] Observations on poplars cultivated in soil for 2 months showed that L23, which had no difference in expression level from wild type (WT), was also similar in plant height to wild type, while the expression level of OsCYP714D1 was significantly higher than that of the wild type transgenic The plant height of the strain was significantly higher than that of the wild type (WT) ( figure 2 A), the stem diameter, leaf area and petiole length are also larger than the wild type ( figure 2 C, D), but there was no significant diff...

Embodiment 3

[0178] Embodiment 3, the analysis of endogenous gene expression

[0179] Using the HPLC method, the inventors measured the contents of endogenous hormones GA and IAA in transgenic poplar and wild-type poplar. The results of the determination and analysis of GA components and IAA content in leaves of wild type and transgenic lines showed that compared with wild type and L23, various GA components and IAA content in OsCYP714D1 gene overexpression lines L4, L13 and L32 The content of IAA was significantly increased ( Figure 6 ).

[0180] Further, the present inventors detected the effect of OsCYP714D1 gene on the expression levels of genes related to GA synthesis and signaling pathways in transgenic poplars and members of the PtCYP714 gene family in poplars. RT-PCR was used to analyze the expression of GA synthesis (GA20ox1,3,4) and decomposition (GA2ox1,2) related genes and GA receptor gene (PtGID1) in wild type and transgenic. The results showed that the RNA levels of these...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for improving plant traits, wherein the subfamily gene 714 of the family of the exogenous cytochrome P450 is transferred in plants. The method can be well applied to improving the plant varieties and provides highly valuable gene resources for culturing new varieties of plants by virtue of molecular breeding techniques such as transgenosis.

Description

technical field [0001] The invention belongs to the fields of genetic engineering and botany, and more particularly relates to a method for improving plant traits. Background technique [0002] Plants are an important source of food and means of production in human society, and almost all human food comes directly or indirectly from plants. With the growth of the world's population, the demand for food is constantly increasing. Improving the yield of plants, especially crops, is the key to the development of human society. Higher plant yield means harvesting more food, fruit or wood under the same cultivated land area, providing strong support for the development of human society. Traditional crop breeding methods include hybrid breeding, mutation breeding, etc. The characteristics of these technologies are relatively slow, directional transformation is not strong, and it takes a long time. Using genetic engineering technology and transgenic technology to increase plant yi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/53C12N15/84A01H5/00
CPCC12N15/8273C12N15/8297C12N15/8261A01H5/00C12N15/82Y02A40/146
Inventor 张洪霞王翠亭
Owner SHANGHAI INST OF BIOLOGICAL SCI CHINESE ACAD OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More