Bisphenol A single-chain antibody and application thereof
A single-chain antibody, antibody technology, used in material testing products, biological testing, peptides, etc., can solve rare problems
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] Example 1 Construction of ribosome-displayed mouse single-chain antibody library
[0042] Amplification of primary antibody library
[0043] 1PCR primers
[0044] VH / for amplified single-chain antibody scFv upstream primer:
[0045]VH / for5'TATATCCATGGCCCAGGTSMARCTGCAG3'
[0046] VL / back amplified single-chain antibody downstream primers:
[0047] VL / back5'CGCGGTTGCGGTCCGTTTBAKYTCCARCTTKGTSCC3'
[0048] T7 / for amplified full library upstream primers:
[0049] T7 / for5'CGCATACGAAATTAATACGACTCAC3'
[0050] PDRS / back amplification full library downstream primers
[0051] PDRS / back5'CCGCACACCAGTAAGGTG3'
[0052] 2 Amplification of the full ribosome display library
[0053]
[0054] Reaction conditions: pre-denaturation at 94°C for 5min; denaturation at 94°C for 30s; annealing at 65°C for 30s; extension at 72°C for 2min10s; 10cycles; denaturation at 94°C for 30s; save. The amplified product was identified by 1.5% agarose gel electrophoresis, and the target fragmen...
Embodiment 2
[0059] a solid phase affinity screening
[0060] All reagent bottles, reagents and microtiter plates in this step should be treated with DEPC water to ensure that there is no RNase contamination.
[0061] (1) Coating screening wells: Dilute the original coated BPA-BSA, BSA or BPA-OVA, OVA with sterile carbonate buffer to 10 μg / mL, add 100 μL to each well of the microplate, and store at 4 °C wrapped overnight;
[0062] (2) Pour off the coating solution, wash the closed wells with sterilized PBS 3 times, each time for 3 minutes; add 200 uL blocking solution (PBS+0.5% BSA) to the screening wells, block for 1 hour, pour off the blocking solution, wash 2 times with PBS, 2min each time; then wash twice with cold WBT, 3min each time. Finally, fill the screening well with cold WBT and place it on ice for at least 20 minutes;
[0063] (3) Transfer the translation products placed on ice (in vitro translation using promega Escherichiacoli (E.coli) S30ExtractSystem) to the prepared scr...
Embodiment 3
[0071] Example 3 Expression and Characterization of Single-Chain Antibody
[0072] 1. Functional expression of anti-bisphenol A single chain antibody
[0073] 1. Amplification of the single-chain antibody gene after screening
[0074] The sequenced and translated completely correct single-chain antibody gene was amplified with the redesigned primers containing restriction sites. The scfv gene with restriction sites was amplified from the pMD18-T-scfv cloning vector. Primers SF-Trx-EcoRI and SR-Xho1-1 contain EcoRI and XhoI restriction sites, respectively.
[0075] SF-Trx-EcoRI (introduce EcoI restriction site): CGCGAATTCTAAATGGCCCAGGT
[0076] SR-XhoI-1 (introduce XhoI restriction site): AATCTACTCGAGCGCGGTTGCGGTCCGTTT
[0077]
[0078] Reaction conditions: pre-denaturation at 94°C for 5min; denaturation at 94°C for 30s; annealing at 56°C for 30s; extension at 72°C for 1min20s; 10cycles; denaturation at 94°C for 30s; save. The amplified product was identified by 1.5% a...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More