Method of promoting generation of lateral buds of Heveabrasiliensis by trans-AtWUS (Arabidopsisthaliana WUSCHEL) gene

A rubber tree and gene technology, applied in the field of plant genetic engineering, can solve problems such as difficulty in lateral buds, achieve the ability to promote, and promote the effect of somatic embryogenesis or organogenesis in rubber trees

Inactive Publication Date: 2014-09-10
RUBBER RES INST CHINESE ACADEMY OF TROPICAL AGRI SCI
View PDF4 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The purpose of the embodiments of the present invention is to provide a method for promoting the occurrence of lateral buds of rubber trees by transducing the AtWUS gene, so as to solve the problem of difficult occurrence of lateral buds in the tissue culture process of rubber trees, and the obtained lateral buds and lateral branches have the potential to be practically applied to grafting

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method of promoting generation of lateral buds of Heveabrasiliensis by trans-AtWUS (Arabidopsisthaliana WUSCHEL) gene
  • Method of promoting generation of lateral buds of Heveabrasiliensis by trans-AtWUS (Arabidopsisthaliana WUSCHEL) gene
  • Method of promoting generation of lateral buds of Heveabrasiliensis by trans-AtWUS (Arabidopsisthaliana WUSCHEL) gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0057] 1) Arabidopsis AtWUS gene cloning and plant expression vector construction, the Arabidopsis AtWUS gene was cloned, and pCAMBIA2301-35s-AtWUS plant expression vector was constructed;

[0058] Weigh 0.5 g of fresh leaves of Arabidopsis thaliana, extract Arabidopsis RNA, and synthesize cDNA using the Transtart IIFirst-strand cDNA synthesis supermix kit, design a pair of specific primers according to the ORF of the AtWUS gene with the accession number NM_127349 in NCBI, and the upstream primer is WF:5' CGGGATCCCGATGGAGCCGCCACAGC3', the downstream primer is WR: 5'GCGAGCTCGCCTAGTTCAGACGTAGCTCAAGAGAAG3', add a BamHI and SacI restriction site at the 5' end of the upstream and downstream primers;

[0059] Using the synthesized AtWUS cDNA as a template, WF and WR as specific primers, PCR (polymerase chain reaction) was used to amplify the AtWUS gene, and the PCR product was observed by agarose gel (1.0%) electrophoresis and gel imaging system, excised Weigh the target fragment wi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method of promoting generation of lateral buds of a Heveabrasiliensis by a trans-AtWUS (Arabidopsisthaliana WUSCHEL) gene. Genetic transformation is carried out on a fragile embryonic callus of the Heveabrasiliensis by adopting the AtWUS gene to obtain a transgenetic material to promote generation of the lateral buds of the Heveabrasiliensis and to form lateral branches, so that the function of the AtWUS gene is verified, which shows that the WUS gene has an important effect on generation of the lateral buds and formation of the lateral branches of the Heveabrasiliensis. The lateral buds and lateral branches obtained have actual application potential. By means of the agrobacterium-mediated method, a plant expression vector is established to transfer the AtWUS gene to the callus of the Heveabrasiliensis to obtain the transgenetic material so as to promote somatic embryogenesis or organogenesis of the Heveabrasiliensis and promote the ability of forming a regeneration plant or a budling according to the property that the plant stem cell determinant gene WUS has a key effect on the meristem of a plant and promotes somatic embryogenesis and / or organogenesis. The method serves application and production from a novel path of genetic engineering of the Heveabrasiliensis.

Description

technical field [0001] The invention belongs to the technical field of plant genetic engineering, and in particular relates to a method for promoting the occurrence of lateral buds of rubber trees by transferring the AtWUS gene. Background technique [0002] Plant somatic embryogenesis and organogenesis are extremely complex processes. Recent studies have shown that many genes are involved in the regulation of plant somatic embryogenesis, among which WUS (WUSCHEL) gene is a typical stem cell determining gene. In 1996, Laux et al identified WUS using EMS mutagenesis technology, and found that its gene mutants affected the development of apical meristem and floral meristem, thus inferring that WUS plays a key role in apical meristem and floral meristem sex and maintain the unity of structure and function. Mayer et al found that WUS encodes 291 amino acids and is a new subtype of homeodomain protein. During the development of plant embryos, WUS gene is expressed in the centr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/82A01H5/00C12Q1/68
Inventor李哲毕政鸿戴雪梅黄华孙林位夫周建南
OwnerRUBBER RES INST CHINESE ACADEMY OF TROPICAL AGRI SCI