Kit for simultaneously detecting parainfluenza virus types 1-4, coronavirus 229E and rhinovirus and pathogen detection method
A pathogen detection, coronavirus technology, applied in biochemical equipment and methods, microbial determination/inspection, resistance to vector-borne diseases, etc., can solve the problems of false positives, laboratory contamination, low sensitivity, etc. The generation of primer-dimers, solving the effects of low detection sensitivity and low amplification efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0113] The kit for simultaneously detecting parainfluenza virus types 1 to 4, coronavirus 229E and rhinovirus of the present invention comprises,
[0114] Positive control: Escherichia coli with parainfluenza virus type 1 gene fragment, Escherichia coli with parainfluenza virus type 2 gene fragment, Escherichia coli with parainfluenza virus type 3 gene fragment, and parainfluenza virus type 4 gene Escherichia coli with fragments, Escherichia coli with coronavirus 229 gene fragments, and Escherichia coli with rhinovirus gene fragments.
[0115] Pathogen-specific primers:
[0116] Parainfluenza virus type 1 specific primers
[0117] Upstream primer: GAGATCTCACACAATTAATAGAGAAGTCA (5'-3');
[0118] Downstream primer: CCTACGGGACATTCTCAGAA(5'-3');
[0119] Parainfluenza virus type 2 specific primers
[0120] Upstream primer: ACCTAAGTGATGGAATCAATCGC (5'-3');
[0121] Downstream primer: TGCCCTGTTGTATTTGGAAGAGAT (5'-3');
[0122] Parainfluenza virus type 3 specific primers
[01...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
