Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Kit for simultaneously detecting parainfluenza virus types 1-4, coronavirus 229E and rhinovirus and pathogen detection method

A pathogen detection, coronavirus technology, applied in biochemical equipment and methods, microbial determination/inspection, resistance to vector-borne diseases, etc., can solve the problems of false positives, laboratory contamination, low sensitivity, etc. The generation of primer-dimers, solving the effects of low detection sensitivity and low amplification efficiency

Inactive Publication Date: 2014-09-24
SHENZHEN CENT FOR DISEASE CONTROL & PREVENTION
View PDF1 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in practice, the number of single-color fluorescent channels that can be detected in the PCR instrument is limited after all, and there can be 3-5 at most, so it cannot meet the simultaneous detection of more pathogens in one use.
Moreover, Tem-PCR still has some shortcomings. For example, in the implementation process, when several fluorescent markers are mixed together, the sensitivity is lower than that of real-time PCR, the amplification time is longer than that of traditional PCR, and the PCR reaction is opened during detection. In spite of the possibility of laboratory contamination and false positives, as well as the fact that the amplification and detection of target genes have not yet been integrated, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for simultaneously detecting parainfluenza virus types 1-4, coronavirus 229E and rhinovirus and pathogen detection method
  • Kit for simultaneously detecting parainfluenza virus types 1-4, coronavirus 229E and rhinovirus and pathogen detection method
  • Kit for simultaneously detecting parainfluenza virus types 1-4, coronavirus 229E and rhinovirus and pathogen detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0113] The kit for simultaneously detecting parainfluenza virus types 1 to 4, coronavirus 229E and rhinovirus of the present invention comprises,

[0114] Positive control: Escherichia coli with parainfluenza virus type 1 gene fragment, Escherichia coli with parainfluenza virus type 2 gene fragment, Escherichia coli with parainfluenza virus type 3 gene fragment, and parainfluenza virus type 4 gene Escherichia coli with fragments, Escherichia coli with coronavirus 229 gene fragments, and Escherichia coli with rhinovirus gene fragments.

[0115] Pathogen-specific primers:

[0116] Parainfluenza virus type 1 specific primers

[0117] Upstream primer: GAGATCTCACACAATTAATAGAGAAGTCA (5'-3');

[0118] Downstream primer: CCTACGGGACATTCTCAGAA(5'-3');

[0119] Parainfluenza virus type 2 specific primers

[0120] Upstream primer: ACCTAAGTGATGGAATCAATCGC (5'-3');

[0121] Downstream primer: TGCCCTGTTGTATTTGGAAGAGAT (5'-3');

[0122] Parainfluenza virus type 3 specific primers

[01...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a kit for simultaneously detecting parainfluenza virus types 1-4, coronavirus 229E and rhinovirus, which comprises specific primers for all pathogens and gene probes for all the pathogens. On the basis of the multiplex fluorescence real-time PCR (polymerase chain reaction) and Tem-PCR techniques, the kit for simultaneously detecting parainfluenza virus types 1-4, coronavirus 229E and rhinovirus adopts the specifically-designed pathogen primers and pathogen gene probes to perform RT-PCR (reverse transcription-polymerase chain reaction), thereby greatly enhancing the amplification efficiency; and thus, the common Taq DNA (deoxyribonucleic acid) can be utilized to obtain very high detection sensitivity of the detection result, thereby solving the problems of low efficiency and low detection sensitivity in the traditional multiplex PCR amplification.

Description

technical field [0001] The invention belongs to the technical field of virus detection kits, and in particular relates to a kit and a pathogen detection method for simultaneously detecting parainfluenza virus types 1 to 4, coronavirus 229E and rhinovirus. Background technique [0002] Some symptoms of influenza are mostly caused by one or more co-infection of parainfluenza virus 1-4, coronavirus 229E and rhinovirus. For example, 1.9% of all pathogen-infected respiratory diseases are infected with various bacterial species. Pathogens, 2.1% were infected with multiple viral pathogens, and 15.2% were co-infected with bacterial and viral pathogens. However, there are currently two methods for the detection of pathogens causing the above symptoms: 1) through tissue culture: to isolate and extract the virus in the cells or directly detect the virus present in the respiratory secretions, and use immunofluorescence experiments, PCR, enzymes, etc. 2) To detect the IgG-specific antib...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/68
CPCC12Q1/686C12Q1/70C12Q2531/113C12Q2537/143C12Q2563/107C12Q2525/301Y02A50/30
Inventor 房师松张然张仁利
Owner SHENZHEN CENT FOR DISEASE CONTROL & PREVENTION
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products