Method and primer composition for detection of Fusarium equiseti based on loop-mediated isothermal amplification technique
A technology of Fusarium equisetia and primer composition, which is applied in the field of methods and primer compositions, can solve the problems of being unable to quickly detect Fusarium equisetia, time-consuming and laborious, and poor specificity, and achieve the expansion of the scope of use and consumption Long-term, high-accuracy effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Detecting Fusarium equisetia in the plant of embodiment 1 field collection
[0035] Soybean Equisetum Fusarium Detection Kit, including the following components:
[0036] Four specific primers FIP, BIP, F3, B3 and two loop primers LF, LB for molecular detection of Fusarium equisetia LAMP:
[0037] F3 (forward outer primer): GCGTACCCGGTACCGAAT (18bp, SEQ ID NO.4);
[0038] B3 (reverse outer primer): GGACTGGTGACAGACTTGTT (20bp, SEQ ID NO.5);
[0039] FIP (Forward Inner Primer) (F1C+F2):
[0040] GGAGGGTCGAGGGAAGAACTCT-TAGTGCCTCCGTCCCATAC (41bp, SEQ ID NO.2);
[0041] BIP (Reverse Internal Primer) (B1C+B2):
[0042] TGGGATCCTCATCGCTGGGA-CCGAAGCCATAATCCACAGT (40bp, SEQ ID NO. 3).
[0043] LF (loop primer): TGCCAGGAGATGCAAGAAGT (20bp, SEQ ID NO.6)
[0044] LB (loop primer): CGAGCCTCTTGAGAAGAACGCC (22bp, SEQ ID NO.7)
[0045] Kit reaction system
[0046] 1mL detection solution includes: 32mM forward inner primer FIP, 32mM reverse inner primer BIP, 8mM forward outer pr...
Embodiment 2
[0048] In order to verify the specificity of the LAMP method, Fusarium equisetia strains were selected, and Fusarium strains of different species from Fusarium equisetia (Fusarium laminarum; Fusarium graminearum; Fusarium oxysporum; Fusarium solani Fusarium oxysporum; Fusarium nivale; Fusarium avenae; Fusarium moniliforme; Fusarium chrysogenum), and strains of different genera from Fusarium oxysporum (Aspergillus oryzae; Alternaria; flat-headed anthracnose; soybean rust; soybean pseudostem rot bacterium; soybean Phytophthora sojae; soybean charcoal rot; rice blast fungus; oil bottle mold; black sporosporum) DNA as template, get 4 μ l DNA solution, utilize The detection kit of Example 1 is used for LAMP reaction, and the LAMP reaction procedure: 62° C., 60 min. After the amplification reaction, the dye SYBR Green I was added, and the fluorescence was observed visually under sunlight or irradiated with ultraviolet light at a wavelength of 245nm; the results showed that when LAMP...
Embodiment 3
[0050] In order to determine the sensitivity of the LAMP detection method, the DNA concentration of the extracted Fusarium equisetia strain was measured by a spectrophotometer (1 μg / μl), then diluted 10 times with DEPC water, and stored at -70°C as a template. Take 4 μL of 10-fold diluted DNA dilutions of each concentration as a template, and perform LAMP reaction and result observation according to the method in Example 2. The results show that the LAMP method can detect the concentration of 10pg of Fusarium soybean equiseti DNA ( image 3 )
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
