Check patentability & draft patents in minutes with Patsnap Eureka AI!

Method and primer composition for detection of Fusarium equiseti based on loop-mediated isothermal amplification technique

A technology of Fusarium equisetia and primer composition, which is applied in the field of methods and primer compositions, can solve the problems of being unable to quickly detect Fusarium equisetia, time-consuming and laborious, and poor specificity, and achieve the expansion of the scope of use and consumption Long-term, high-accuracy effects

Active Publication Date: 2016-08-24
NANJING AGRICULTURAL UNIVERSITY
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] The object of the present invention is aimed at the problems of long period, time-consuming, laborious, cumbersome and poor specificity for the biological detection method of Fusarium equisetia in the prior art, and PCR detection technology requires a thermal cycle instrument, which cannot quickly detect Fusarium soybean equisetia spores, providing LAMP primer compositions for the detection of Fusarium equisetia

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method and primer composition for detection of Fusarium equiseti based on loop-mediated isothermal amplification technique
  • Method and primer composition for detection of Fusarium equiseti based on loop-mediated isothermal amplification technique
  • Method and primer composition for detection of Fusarium equiseti based on loop-mediated isothermal amplification technique

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Detecting Fusarium equisetia in the plant of embodiment 1 field collection

[0035] Soybean Equisetum Fusarium Detection Kit, including the following components:

[0036] Four specific primers FIP, BIP, F3, B3 and two loop primers LF, LB for molecular detection of Fusarium equisetia LAMP:

[0037] F3 (forward outer primer): GCGTACCCGGTACCGAAT (18bp, SEQ ID NO.4);

[0038] B3 (reverse outer primer): GGACTGGTGACAGACTTGTT (20bp, SEQ ID NO.5);

[0039] FIP (Forward Inner Primer) (F1C+F2):

[0040] GGAGGGTCGAGGGAAGAACTCT-TAGTGCCTCCGTCCCATAC (41bp, SEQ ID NO.2);

[0041] BIP (Reverse Internal Primer) (B1C+B2):

[0042] TGGGATCCTCATCGCTGGGA-CCGAAGCCATAATCCACAGT (40bp, SEQ ID NO. 3).

[0043] LF (loop primer): TGCCAGGAGATGCAAGAAGT (20bp, SEQ ID NO.6)

[0044] LB (loop primer): CGAGCCTCTTGAGAAGAACGCC (22bp, SEQ ID NO.7)

[0045] Kit reaction system

[0046] 1mL detection solution includes: 32mM forward inner primer FIP, 32mM reverse inner primer BIP, 8mM forward outer pr...

Embodiment 2

[0048] In order to verify the specificity of the LAMP method, Fusarium equisetia strains were selected, and Fusarium strains of different species from Fusarium equisetia (Fusarium laminarum; Fusarium graminearum; Fusarium oxysporum; Fusarium solani Fusarium oxysporum; Fusarium nivale; Fusarium avenae; Fusarium moniliforme; Fusarium chrysogenum), and strains of different genera from Fusarium oxysporum (Aspergillus oryzae; Alternaria; flat-headed anthracnose; soybean rust; soybean pseudostem rot bacterium; soybean Phytophthora sojae; soybean charcoal rot; rice blast fungus; oil bottle mold; black sporosporum) DNA as template, get 4 μ l DNA solution, utilize The detection kit of Example 1 is used for LAMP reaction, and the LAMP reaction procedure: 62° C., 60 min. After the amplification reaction, the dye SYBR Green I was added, and the fluorescence was observed visually under sunlight or irradiated with ultraviolet light at a wavelength of 245nm; the results showed that when LAMP...

Embodiment 3

[0050] In order to determine the sensitivity of the LAMP detection method, the DNA concentration of the extracted Fusarium equisetia strain was measured by a spectrophotometer (1 μg / μl), then diluted 10 times with DEPC water, and stored at -70°C as a template. Take 4 μL of 10-fold diluted DNA dilutions of each concentration as a template, and perform LAMP reaction and result observation according to the method in Example 2. The results show that the LAMP method can detect the concentration of 10pg of Fusarium soybean equiseti DNA ( image 3 )

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method and primer composition for detecting fusarium equiseti based on a loop-mediated isothermal amplification technology. The LAMP primer composition for detecting soybean fusarium equiseti consists of a forward inner primer FIP shown in SEQ ID NO.2, a reverse inner primer BIP shown in SEQ ID NO.3, a forward outer primer F3 shown in SEQ ID NO.4, a reverse outer primer B3 shown in SEQ ID NO.5, a loop primer LF shown in SEQ ID NO.6 and a loop primer LB shown in SEQ ID NO.7. The primer composition disclosed by the invention can be applied to preparation of a LAMP detection reagent of soybean fusarium equiseti. The kit has the advantages of good specificity and sensitivity, rapid and high-efficiency amplification and easy and convenient identification operation. The detection system disclosed by the invention can rapidly, conveniently and efficiently detect the soybean fusarium equiseti with high specificity and high sensitivity under the isothermal condition of 62 DEG C.

Description

technical field [0001] The invention belongs to the field of biological detection, and relates to a method and a primer composition for detecting Fusarium equiseti based on a loop-mediated isothermal amplification technology. Background technique [0002] Soybean Fusarium root rot was first reported by Crommell in the United States in 1917 (1), which mainly damages the soybean root system and affects the crop's absorption of water and nutrients. The occurrence of this disease can affect the root activity, root weight, nodule weight, nitrogenase activity and lateral root number of soybean plants to varying degrees (23). According to investigations, diseases can generally reduce soybean production by 10%-30%, and can reach 60% in severe cases. It is now known that the disease is distributed in China, the United States, India, Japan, and the Philippines. (16,20,21,22) is an important disease that seriously affects soybean production in Northeast my country and the Huanghuaihai...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68C12Q1/04C12N15/11C12R1/645
CPCC12Q1/6844C12Q1/6895C12Q2531/119C12Q2563/107
Inventor 郑小波陆辰晨王源超张海峰
Owner NANJING AGRICULTURAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More