Loop-mediated isothermal amplification (LAMP)-based method and primer composition for detection of fusarium graminearum
A technology of Fusarium graminearum and primer composition, applied in the direction of microorganism-based methods, recombinant DNA technology, biochemical equipment and methods, etc., can solve the problem of inability to quickly detect Fusarium graminearum, time-consuming and labor-intensive, and poor specificity and other problems, to achieve the effect of expanding the scope of use, taking a long time, and high accuracy
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] Detection of Fusarium graminearum in the plant of embodiment 1 field collection
[0037] Soybean Fusarium graminearum detection kit, including the following components:
[0038] Four specific primers FIP, BIP, F3, B3 and one loop primer LB for molecular detection of Fusarium graminearum LAMP:
[0039] F3 (forward outer primer): GGGATCCTCATCGTTGGGA (19bp, SEQ ID NO.4);
[0040] B3 (reverse outer primer): AGGCTGTTCAATGTGAACCA (20bp, SEQ ID NO.5);
[0041] FIP (forward internal primer) (F1C+F2)
[0042] TGACGGATTTGCTCATCACCCCGAAGACCGCCGAAGATGG (40bp, SEQ ID NO. 2);
[0043] BIP (Reverse Internal Primer) (B1C+B2):
[0044] TTGCCCTTTGGAGCTGGACGGTGGCAACAATAGCCTCCCA (39bp, SEQ ID NO. 3).
[0045] LB (loop primer): ACATCGATGTGTTGGCGAGAATTA (24bp, SEQ ID NO.6)
[0046] Kit reaction system
[0047] 1mL detection solution includes: 32mM forward inner primer FIP, 32mM reverse inner primer BIP, 8mM forward outer primer F3, 8mM reverse outer primer B3, 8mM loop primer LB, 56mM...
Embodiment 2
[0049] In order to verify the specificity of the LAMP method, a Fusarium graminearum strain of soybean was selected, a Fusarium strain of Fusarium graminearum different from that of Fusarium graminearum (F. Fusarium oxysporum; Fusarium nivale; Fusarium avenae; Fusarium moniliforme; Fusarium chrysogenum), and strains of different genera from Fusarium oxysporum (Aspergillus oryzae; Alternaria; flat-headed anthracnose; soybean rust; soybean pseudostem rot bacterium; soybean phytophthora; soybean charcoal rot; rice blast fungus; oil bottle mold) DNA as template, get 4 μ l DNA solution, utilize the detection of embodiment 1 The kit is used for LAMP reaction. The LAMP reaction program is: 62°C, 60 min. After the amplification reaction is completed, add the dye SYBR Green I, and observe the fluorescence visually under sunlight or under ultraviolet light at a wavelength of 245nm. The results showed that when LAMP primers were used to amplify the DNA template of Fusarium equisetia, a y...
Embodiment 3
[0051] In order to determine the sensitivity of the LAMP detection method, the DNA concentration of the extracted Fusarium graminearum strain was measured with a spectrophotometer (1 μg / μl), and then diluted 10 times with DEPC water, and stored at -70°C as a template. Take 4 μL of 10-fold diluted DNA dilutions of each concentration as a template, and perform LAMP reaction and result observation according to the method in Example 2. The result shows that the DNA of Fusarium graminearum of 100 pg can be detected by LAMP method ( image 3 )
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap