Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Loop-mediated isothermal amplification (LAMP)-based method and primer composition for detection of fusarium graminearum

A technology of Fusarium graminearum and primer composition, applied in the direction of microorganism-based methods, recombinant DNA technology, biochemical equipment and methods, etc., can solve the problem of inability to quickly detect Fusarium graminearum, time-consuming and labor-intensive, and poor specificity and other problems, to achieve the effect of expanding the scope of use, taking a long time, and high accuracy

Active Publication Date: 2015-01-28
NANJING AGRICULTURAL UNIVERSITY
View PDF3 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0009] The purpose of the present invention is to solve the problems that the biological detection method of Fusarium graminearum in the prior art requires a long cycle, time-consuming, laborious, cumbersome, and poor specificity, and PCR detection technology requires a thermal cycle instrument, which cannot quickly detect soybean grains. To solve the problem of Fusarium graminearum, a new molecular detection method for Fusarium graminearum was provided, and LAMP detection for Fusarium graminearum was performed, with a short detection cycle (only 1 hour), high accuracy, high sensitivity, and Observe the test results

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Loop-mediated isothermal amplification (LAMP)-based method and primer composition for detection of fusarium graminearum
  • Loop-mediated isothermal amplification (LAMP)-based method and primer composition for detection of fusarium graminearum
  • Loop-mediated isothermal amplification (LAMP)-based method and primer composition for detection of fusarium graminearum

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Detection of Fusarium graminearum in the plant of embodiment 1 field collection

[0037] Soybean Fusarium graminearum detection kit, including the following components:

[0038] Four specific primers FIP, BIP, F3, B3 and one loop primer LB for molecular detection of Fusarium graminearum LAMP:

[0039] F3 (forward outer primer): GGGATCCTCATCGTTGGGA (19bp, SEQ ID NO.4);

[0040] B3 (reverse outer primer): AGGCTGTTCAATGTGAACCA (20bp, SEQ ID NO.5);

[0041] FIP (forward internal primer) (F1C+F2)

[0042] TGACGGATTTGCTCATCACCCCGAAGACCGCCGAAGATGG (40bp, SEQ ID NO. 2);

[0043] BIP (Reverse Internal Primer) (B1C+B2):

[0044] TTGCCCTTTGGAGCTGGACGGTGGCAACAATAGCCTCCCA (39bp, SEQ ID NO. 3).

[0045] LB (loop primer): ACATCGATGTGTTGGCGAGAATTA (24bp, SEQ ID NO.6)

[0046] Kit reaction system

[0047] 1mL detection solution includes: 32mM forward inner primer FIP, 32mM reverse inner primer BIP, 8mM forward outer primer F3, 8mM reverse outer primer B3, 8mM loop primer LB, 56mM...

Embodiment 2

[0049] In order to verify the specificity of the LAMP method, a Fusarium graminearum strain of soybean was selected, a Fusarium strain of Fusarium graminearum different from that of Fusarium graminearum (F. Fusarium oxysporum; Fusarium nivale; Fusarium avenae; Fusarium moniliforme; Fusarium chrysogenum), and strains of different genera from Fusarium oxysporum (Aspergillus oryzae; Alternaria; flat-headed anthracnose; soybean rust; soybean pseudostem rot bacterium; soybean phytophthora; soybean charcoal rot; rice blast fungus; oil bottle mold) DNA as template, get 4 μ l DNA solution, utilize the detection of embodiment 1 The kit is used for LAMP reaction. The LAMP reaction program is: 62°C, 60 min. After the amplification reaction is completed, add the dye SYBR Green I, and observe the fluorescence visually under sunlight or under ultraviolet light at a wavelength of 245nm. The results showed that when LAMP primers were used to amplify the DNA template of Fusarium equisetia, a y...

Embodiment 3

[0051] In order to determine the sensitivity of the LAMP detection method, the DNA concentration of the extracted Fusarium graminearum strain was measured with a spectrophotometer (1 μg / μl), and then diluted 10 times with DEPC water, and stored at -70°C as a template. Take 4 μL of 10-fold diluted DNA dilutions of each concentration as a template, and perform LAMP reaction and result observation according to the method in Example 2. The result shows that the DNA of Fusarium graminearum of 100 pg can be detected by LAMP method ( image 3 )

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a loop-mediated isothermal amplification (LAMP) technology-based method and primer composition for detection of fusarium graminearum, and the LAMP primer composition for detection of soybean fusarium graminearum comprises a forward inner primer (FIP) as shown by SEQ ID NO.2, a backward inner primer (BIP) as shown by SEQ ID NO.3, a forward outer primer (F3) as shown by SEQ ID NO.4, a backward outer primer (B3) as shown by SEQ ID NO.53, and a loop primer (LB) as shown by SEQ ID NO.6. The primer composition is used for detection of soybean fusarium graminearum. The detection system can be used for fast, convenient, high efficiency, high specificity and high sensitive detection of soybean fusarium graminearum without complex instruments, and can well satisfy the field detection of soybean fusarium graminearum.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to a method for detecting Fusarium graminearum based on a loop-mediated isothermal amplification technique and a primer composition. Background technique [0002] Soybean Fusarium root rot mainly damages the soybean root system and affects the crop's absorption of water and nutrients. The occurrence of this disease can affect the root activity, root weight, root nodule weight, nitrogenase activity and lateral root number of soybean plants to varying degrees. It was first reported by Crommell in 1917 in the United States. According to investigations, the disease can generally reduce soybean yield by 10%-30%, and can reach 60% in severe cases. It is known that the disease is distributed in China, the United States, India, Japan, the Philippines and other countries. It is an important disease that seriously affects soybean production in Northeast my country and the Huanghuaihai region, espe...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12Q1/04C12N15/11C12R1/77
CPCC12Q1/6844C12Q2531/119
Inventor 郑小波陆辰晨王源超张海峰
Owner NANJING AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com