Radiation-resistant peptide mutant protein and application of mutant protein in reducing inflammatory response

An inflammatory response and protein technology, applied in the fields of peptide/protein components, applications, animal/human proteins, etc., can solve problems such as cold syndrome-like side effects

Active Publication Date: 2015-01-07
INST OF RADIATION MEDICINE ACAD OF MILITARY MEDICAL SCI OF THE PLA
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, because the radioresistant peptide protein stimulates a variety of cytokines through TLR and NLR, in addition to playing an anti-radiation effect, some of the cytokines also participate in the inflammatory response, which can lead to cold syndrome-like side effects

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Radiation-resistant peptide mutant protein and application of mutant protein in reducing inflammatory response
  • Radiation-resistant peptide mutant protein and application of mutant protein in reducing inflammatory response
  • Radiation-resistant peptide mutant protein and application of mutant protein in reducing inflammatory response

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1, the acquisition of radioresistant peptide mutant L292A

[0038] 1. Acquisition of vector expressing radioresistant peptide mutant L292A

[0039] Synthesize the following point mutation primers:

[0040] Radioantipeptide-I213A-F: TAACCCACTGGCTTCA GC TGATTCTGCATTGTCA

[0041] Radioantipeptide-I213A-R: TGACAATGCAGAATCAGCTGAAGCCAGTGGGTTA

[0042] Radioresistant peptide-L292A-F: TTCCGCAAAACGTC GCG TCTTTACTGCGTTA

[0043] Radioresistant peptide-L292A-R: TAACGCAGTAAAGACGCGACGTTTTGCGGAA

[0044] In order to clone the full-length sequence of the radioresistant peptide into the pBV220 prokaryotic expression vector, the PCR method was used to pMD-18T-FKT (Wang Zhidong et al., CBLB502 protein prokaryotic expression and radiation protection verification, Chinese Journal of Radiation Medicine and Protection, 2010 (30) 4:169-172, which can be obtained from the Institute of Radiation and Radiation Medicine, Academy of Military Medical Sciences of the Chinese People’s...

Embodiment 2

[0060] Example 2. Application of radioresistant peptide mutant L292A in reducing the inflammatory response caused by it

[0061] 1. Activity detection of radioresistant peptide mutant L292A

[0062] Alkaline phosphatase reporter gene detection is used, as follows:

[0063] Resuscitate HEK293T cells and place in an incubator at 37 °C, 5% CO 2 Under normal conditions, cultured in H-DMEM medium. When the 293T cells in the 24-well plate were cultivated until the cell density reached 70%, each well of cells was transfected with 50ng pcDNA-3.1 / hTLR5 plasmid (Wang Lei et al., The radioprotective effect of Toll-like receptor 5 agonist CBLB502 protein, International Journal of Pharmaceutical Research Volume 39, Issue 3, June 2012, 225-230, the public can obtain from the Institute of Radiation and Radiation Medicine, Academy of Military Medical Sciences of the Chinese People's Liberation Army), 100ng100ng pNF-κB / SEAP plasmid (IMGENEX, IMK-515), 2ng pRL -TK plasmid (Promega, E2241) wa...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a radiation-resistant peptide mutant protein and application of mutant protein in reducing inflammatory response. The protein is the following (a) or (b): (a) protein comprising amino acid sequences represented by the sequence 4 in a sequence table; and (b) protein obtained by the substitution and / or deletion and / or addition of the amino acid sequences represented by the sequence 4 in the sequence table through one or more amino acid residues and derived from the sequence 4 and having the same function. Experimental results show that by virtue of the radiation-resistant peptide mutant protein, the confirmatory reaction caused by the radiation-resistant peptide mutant protein can be reduced, the 292nd leucine of the radiation-resistant peptide is mutated and mainly involved in binding NLRs so that the binding capacity of the radiation-resistant peptide with NLR (NOD-like Receptor) and the NLR path-mediated inflammatory reaction is further reduced after the radiation-resistant peptide is injected into an animal and however, the TLR (Toll-like Receptor) 5-mediated radiation-resistant biological activity is not significantly reduced.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a radioresistant peptide mutant protein and its application in reducing inflammation. Background technique [0002] Toll-like receptor (Toll-like receptor, TLR) family participates in the natural immune process in the body, and is a family of innate immune receptors mediated by microorganisms. It can activate the NF-κB signaling pathway by specifically recognizing pathogen-related molecular patterns such as bacteria and viruses (Takeda K, et al. Toll-like receptors. Annu Rev Immunol, 2003, 21:335-376. Medzhitov R. Approaching the asymptote : 20year later. Immunity, 2009, 3:766-775.). TLR was found by Lemaitre et al. in the study of Drosophila in 1996 to participate in the immune response process caused by fungal infection and play an important role. Current studies have shown that 11 TLRs family members have been found in the human body, and they are mainly expressed in immune cell...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K14/705C12N15/12C12N15/63C12N1/15C12N1/21C12N1/19A61K38/17A61P39/00A61P37/02
CPCA61K38/00C07K14/255
Inventor杨晓明葛常辉詹逸群来丽丽王磊
OwnerINST OF RADIATION MEDICINE ACAD OF MILITARY MEDICAL SCI OF THE PLA