Genetic element applicable to genetic modification of thermophilic microorganisms, carrier and application thereof

A technology of thermophilic microorganisms and genetic transformation, which is applied to the genetic elements of thermophilic microorganisms genetic transformation and its carrier and application field, can solve the problems that thermophilic microorganisms cannot be applied, and achieve low conversion efficiency requirements, high gene inactivation efficiency, Wide host range effect

Active Publication Date: 2015-01-21
QINGDAO INST OF BIOENERGY & BIOPROCESS TECH CHINESE ACADEMY OF SCI +1
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, the mesophilic targetron technology has been widely used in the targeted inactivation of genes in a variety of microorganisms, but the currently used targetron systems are all based on the mesophilic (37°C-42°C) type II intronic elements. A mesophilic type II intronic element that cannot work under high temperature conditions (48°C-65°C), so it cannot be used in thermophilic microorganisms (such as C.thermocellum)[2,3]

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Genetic element applicable to genetic modification of thermophilic microorganisms, carrier and application thereof
  • Genetic element applicable to genetic modification of thermophilic microorganisms, carrier and application thereof
  • Genetic element applicable to genetic modification of thermophilic microorganisms, carrier and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Whole-gene synthesis of the thermophilic type II intronic element TeI3c-4c:

[0039] Thermosynechococcus elongates BP-1 strain contains 28 type IIB introns. They are closely related and are thought to have evolved from a common ancestor, with lateral transfer into the genome of the microorganism [8,12,13]. It synthesized the TeI3c type II intron gene (873nt, 5'-end SpeI, 3'-end PstI) while mutating its 20, 319, 321, 337, 339 A, T, A, T, A sequences into T, A, G respectively , C, T form the SpeI-BsiwI restriction site (sequence). The SpeI-BsiwI digestion fragment is 357bp long, covering IBS1-IBS2, EBS1, EBS2, and can be quickly replaced with the target DNA recognition sequence by enzyme digestion and ligation. In addition, wild-type TeI3c itself does not encode an RT enzyme, and the RT enzyme encoded by TeI4c can promote the "retrohoming" of TeI3c. Therefore, the gene encoding the RT enzyme of TeI4c was synthesized (1701nt, 5'-end PstI, 3'-end XhoI, sequence) and conn...

Embodiment 2

[0063] Construction of the high-temperature microbial gene targeting vector pHK-TT1A based on TeI3c-4c——Thermotargetron

[0064] The process of constructing the thermotargetron plasmid pHK-TT1A plasmid is divided into three steps:

[0065] In the first step, the C.thermcellum chaperone protein Cpn10 (Clo1313_0432) promoter PgroEL was cloned upstream of the TeI3c intron / TeI4RT element. The specific process is to use Ct_PgroEL5-BamHI, Ct_PgroEL3-SpeI-XhoI-EcoRI primers (Table 2) to amplify the groEL promoter from the genome of Clostridium thermocellum DSM1313, and the PCR product BamHI and EcoRI are digested and ligated into the pIKM1 plasmid[14] Obtain pIKM1PgroEL plasmid;

[0066] In the second step, the 897nt TeI3c intron DNA sequence (SpeI / PstI) synthesized in Example 1 was cloned into the corresponding site of the pIKM1PgroEL plasmid after double digestion with SpeI and PstI to obtain the pIKM1PgroEL-TeI3c plasmid; the 1710nt TeI4c synthesized in Example 1 RT enzyme gene ...

Embodiment 3

[0072] The function of the thermophilic type II intron element TeI3c-4c was tested in Escherichia coli as a host:

[0073] 1) Effect of temperature on the "homing" efficiency of TeI3c-4c type II intron in E. coli (TeI3c-4c "homing" test):

[0074] The principle of the TeI3c-4c "homing" test is: the DIV region carries the TeI3c-4c intron donor plasmid pACD2X-TeI3c-4c[15] containing the T7 promoter (acgcgtaatacgactcactataggg) (see Figure 4 ) can recognize and insert the ampicillin-resistant intron acceptor plasmid pBRR-3C E1, E2 (exon) site (Table 1). The pBRR-3C plasmid carries a tetracycline resistance gene without a promoter behind the E1 and E2 sites. When the TeI3c intron of the donor plasmid "homing" to the E1 and E2 sites of the acceptor plasmid, the T7 promoter carried in the DIV region of the donor plasmid promotes the expression of the tetracycline resistance gene, so that the intron "homing" occurs Escherichia coli strains acquire tetracycline resistance, so the "h...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to molecular biology, specifically to a genetic element applicable to genetic modification of thermophilic microorganisms, a carrier and application thereof. The element is a thermophilic type-II intron element TeI3c-4c, shown by a nucleotide sequence in sequence tables SEQ ID NO.1 and 2. A targeting vector of the genetic element for genetic modification of the thermophilic microorganisms is applied to the thermophilic microorganisms, thereby subjecting the thermophilic microorganisms to gene targeting inactivation. According to the invention, Thermotargetron is used and applied to a type-II intron-based genetic inactivation tool for the thermophilic microorganisms. The advantages are that the genetic inactivation efficiency is high; the targeting point can be easily changed (the targeting carrier establishment period is short); the host range is wide (applicability to Gram positive and negative bacteria); no nutritional deficiency selection marker is needed; the requirement on conversion efficiency is low; and inactivation of relatively-short (100-200bp) gene sequences can be performed.

Description

technical field [0001] The invention relates to molecular biology, in particular to a gene element suitable for genetic modification of thermophilic microorganisms, its carrier and application. Background technique [0002] The gene knockout method based on the targetron system has the advantages of simple operation, short cycle, high efficiency, no need for resistance screening, and low requirements for transformation efficiency. It can make up for the shortcomings of the homologous recombination method and has been widely used in basic research and engineering strains. transformation. [0003] The principle of gene inactivation of type II intron is RNA "retrohoming". Taking the Ll.LtrB intron as an example, the gene inactivation of type II intron is carried out in two stages (see figure 1 ): 1) The Ll.LtrB intron (ribozyme) self-cleaves to form a "lasso" structure; 2) the type II intron that self-cleaves to form a "lasso" structure and IEP with reverse transcriptase activ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/11C12N15/63C12N1/21
Inventor崔球洪伟乔治·莫尔艾伦·莱伯维兹刘亚君冯银刚
OwnerQINGDAO INST OF BIOENERGY & BIOPROCESS TECH CHINESE ACADEMY OF SCI