Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for targetedly integrating exogenous gene into target gene

A technology of exogenous gene and fixed-point integration, which is applied in the field of genetic engineering, can solve problems such as complex construction steps, low recombination efficiency, and abnormal recombination, and achieve the effects of simple construction steps, improved integration efficiency, and reduced molecular reagents

Inactive Publication Date: 2015-02-11
HANGZHOU NORMAL UNIVERSITY
View PDF1 Cites 53 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, gene recombination targeting technology faces disadvantages such as low recombination efficiency, complicated construction steps, and abnormal recombination.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for targetedly integrating exogenous gene into target gene
  • Method for targetedly integrating exogenous gene into target gene
  • Method for targetedly integrating exogenous gene into target gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] 1. Construction and preparation of recombinant exogenous gene Cre vector, named: pCre-Knockin, the sequence is shown in SEQ ID NO.1.

[0052] (1) Model diagram of pCre-Knockin recombinant expression vector construction, such as figure 2 , ApaI, AatII, SphI, NcoI, and SacII are all designed multiple cloning sites for connecting target genes.

[0053] (2) Design primers

[0054] A pair of primers were designed according to the GFP-Cre vector sequence, and the T2A sequence (underlined part) was added before the forward primer.

[0055] pCre-F (forward primer):

[0056] GAGGGCAGAGGAAGTCTTCTAACATGCGGTGACGTGGAGGAGAATCCCGGCCC T ATGTCCAATTTACTGACCGT

[0057] pCre-R (reverse primer): ATAAGAGAAGAGGGACAGCT

[0058] (3) Preparation and verification of recombinant exogenous gene Cre vector

[0059] 1) Acquisition of recombinant exogenous gene Cre vector: use GFP-Cre plasmid as a template, carry out PCR reaction under the action of primer pCre-F and primer pCre-R, after the ...

Embodiment 2

[0140] 1) Design Enpp1 sgRNA for Enpp1 gene, the sequence is as SEQ ID NO.6; add BbsI restriction site at the 5' end of sgRNA, as follows (underlined restriction site).

[0141] sgRNA-Enpp1-F: CACCG GGCTTCGCTGCTCGCGCCCA

[0142] sgRNA-Enpp1-R: AAAC TGGGCGCGAGCAGCGAAGCCC

[0143] Denaturation, annealing reaction system is as follows:

[0144]

[0145] The reaction system in the PCR instrument is as follows: 37°C for 30 minutes; 95°C for 5 minutes; 95-25°C, 5°C / min.

[0146] After denaturation and annealing, the obtained product sgRNA-Enpp1 was connected to the pGEM-sgRNA carrier (sequence shown in SEQ ID NO.5), and the ligation reaction was performed at 25°C for 1 hour. After the reaction, 2 μl of the connection solution was used to transform 50 μl of Escherichia coli DH5α. State cells, ice-bathed for 30min, heat-shocked at 42°C for 60s, added 500μl LB liquid medium after ice-bathed for 2min, placed in a shaker at 37°C and 200rpm for 1h, took 200μl culture solution and...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for targetedly integrating an exogenous gene into a target gene of a mammal, which is implemented by targetedly integrating an exogenous gene into a target gene by utilizing a CRISPR / Cas9 system, and especially targetedly integrating a Cre gene to a first exon of a mouse Enpp1 gene. The technique has the advantages of high integration efficiency (20%) and simple operation step, only needs to construct one exogenous gene vector, and can not be influenced by the position effect.

Description

(1) Technical field [0001] The present invention belongs to the field of genetic engineering, specifically, it mainly relates to the construction method of exogenous gene knock-in and overexpression vector and the ability to integrate the exogenous gene on the vector and the overexpressed target gene into the genome relying on CRISPR / Cas9 technology specific site. (2) Background technology [0002] In recent years, my country's pharmaceutical industry has developed rapidly, but at the same time there are many problems, such as weak research and development foundation, flood of imitation of foreign patents, lack of independent intellectual property rights, etc., which seriously restrict the development of my country's pharmaceutical industry. Therefore, it is urgent to enhance my country's drug research and development capabilities. The process of drug research and development is the process of disease pathogenesis and drug target screening. Most of the screening process rel...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/89C12N15/85
Inventor 陈勇龙黄华荣张遵义羊雪芹
Owner HANGZHOU NORMAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com