Method for targetedly integrating exogenous gene into target gene
A technology of exogenous gene and fixed-point integration, which is applied in the field of genetic engineering, can solve problems such as complex construction steps, low recombination efficiency, and abnormal recombination, and achieve the effects of simple construction steps, improved integration efficiency, and reduced molecular reagents
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0051] 1. Construction and preparation of recombinant exogenous gene Cre vector, named: pCre-Knockin, the sequence is shown in SEQ ID NO.1.
[0052] (1) Model diagram of pCre-Knockin recombinant expression vector construction, such as figure 2 , ApaI, AatII, SphI, NcoI, and SacII are all designed multiple cloning sites for connecting target genes.
[0053] (2) Design primers
[0054] A pair of primers were designed according to the GFP-Cre vector sequence, and the T2A sequence (underlined part) was added before the forward primer.
[0055] pCre-F (forward primer):
[0056] GAGGGCAGAGGAAGTCTTCTAACATGCGGTGACGTGGAGGAGAATCCCGGCCC T ATGTCCAATTTACTGACCGT
[0057] pCre-R (reverse primer): ATAAGAGAAGAGGGACAGCT
[0058] (3) Preparation and verification of recombinant exogenous gene Cre vector
[0059] 1) Acquisition of recombinant exogenous gene Cre vector: use GFP-Cre plasmid as a template, carry out PCR reaction under the action of primer pCre-F and primer pCre-R, after the ...
Embodiment 2
[0140] 1) Design Enpp1 sgRNA for Enpp1 gene, the sequence is as SEQ ID NO.6; add BbsI restriction site at the 5' end of sgRNA, as follows (underlined restriction site).
[0141] sgRNA-Enpp1-F: CACCG GGCTTCGCTGCTCGCGCCCA
[0142] sgRNA-Enpp1-R: AAAC TGGGCGCGAGCAGCGAAGCCC
[0143] Denaturation, annealing reaction system is as follows:
[0144]
[0145] The reaction system in the PCR instrument is as follows: 37°C for 30 minutes; 95°C for 5 minutes; 95-25°C, 5°C / min.
[0146] After denaturation and annealing, the obtained product sgRNA-Enpp1 was connected to the pGEM-sgRNA carrier (sequence shown in SEQ ID NO.5), and the ligation reaction was performed at 25°C for 1 hour. After the reaction, 2 μl of the connection solution was used to transform 50 μl of Escherichia coli DH5α. State cells, ice-bathed for 30min, heat-shocked at 42°C for 60s, added 500μl LB liquid medium after ice-bathed for 2min, placed in a shaker at 37°C and 200rpm for 1h, took 200μl culture solution and...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com