Recombinant bacillus subtilis for producing chondroitin and application of recombinant bacillus subtilis

A technology of Bacillus subtilis and chondroitin, which is applied in the field of bioengineering, can solve problems such as inability to meet food medical safety requirements, and achieve the effects of high production intensity, simple culture cost, and large application advantages.

Active Publication Date: 2015-03-04
JIANGNAN UNIV
View PDF7 Cites 19 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the pathogenicity of the above-mentioned strains and the production of endotoxin and pyrogen substances by Escherichia coli, they cannot meet the current food medical safety requirements.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant bacillus subtilis for producing chondroitin and application of recombinant bacillus subtilis
  • Recombinant bacillus subtilis for producing chondroitin and application of recombinant bacillus subtilis
  • Recombinant bacillus subtilis for producing chondroitin and application of recombinant bacillus subtilis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1 Construction of integrated recombinant plasmid pAX01-KfoC-KfoA

[0038] The UDP-GlcNAc C4 isomerase KfoA and chondroitin synthase KfoC used in this example are derived from Escherichia coli K4 (E.coli serotype O5:K4(L):H4, E.coli K4), inoculated with E.coliK4 strain In 5ml of LB liquid medium, cultured at 37°C at 200rpm for 16h. The bacterial cells were collected, and the genomic DNA of E.coliK4 strain was extracted using a bacterial genome extraction kit.

[0039] According to the published genome information sequence, primers KfoA-F / R and KfoC-F / R were designed respectively, and the KfoC and KfoA genes were obtained by using the extracted genomic DNA as a template and using a standard PCR amplification system and procedure.

[0040] Primer sequence information: 5'-3' direction

[0041] KfoC-F:CGGGATCCATGAGTATTCTTAATCAAGC

[0042] KfoC-R: TCCCCGCGGACTTCGGGTACCTTATAAATCATTCTCTATTTTTTCC

[0043] KfoA-F:CGGGGTACCAAGAGAGGAATGTACACATGAATATATTAGTTACAGGTGG

[0...

Embodiment 2

[0047] Example 2 Construction of recombinant plasmids pP43NMK / tuaD, pP43NMK / tuaD-gtaB

[0048] Bacillus subtilis 168 strain was inoculated in 5 ml of LB medium, and cultured at 37° C. and 200 rpm for 16 h. The bacterial cells were collected, and the genomic DNA of S. zooepidemicus strains was extracted using a bacterial genome extraction kit. According to the published genome information sequence of Bacillus subtilis168, primers tuaD-F / tuaD-R and gtaB-F / gtaB-R were designed respectively. KpnI restriction site and P43RBS sequence were introduced at the 5 end of the upstream primer tuaD-F, and XhoI and SacI restriction sites were introduced at the 5 end of the downstream primer tuaD-R; at the 5 end of the upstream primer gtaB-F SacI restriction site and P43RBS sequence were introduced, and XhoI and XbaI restriction sites were introduced at the 5 end of the downstream primer gtaB-R.

[0049] The primer information is as follows:

[0050] tuaD-F:CGGGGTACCAAGAGAGGAATGTACACATGAAA...

Embodiment 3

[0057] Example 3 Construction of recombinant plasmids pP43NMK / glmU, pP43NMK / glmU-glmM

[0058] Primers glmU-F / glmU-R and glmM-F / glmM-R were designed according to the published genome information sequence of Bacillus subtilis 168. KpnI restriction site and P43RBS sequence were introduced at the 5 end of the upstream primer glmU-F, XhoI and XbaI restriction sites were introduced at the 5 end of the downstream primer glmU-R, and SpeI and XbaI were used for the following genes. Homocaudal enzyme was used for ligation; SpeI restriction site and P43RBS sequence were introduced at the 5 end of the upstream primer glmM-F, and XhoI and XbaI restriction sites were introduced at the 5 end of the downstream primer glmM-R.

[0059] The primer information is as follows:

[0060] glmU-F:CGGGGTACCAAGAGAGGAATGTACACATGGATAAGCGGTTTGCAGTTG

[0061] glmU-R:CCGCTCGAGCGGACTCTAGTCTAGATTATTTTTTATGAATATTTTTCAC

[0062] glmM -F: GGACTAGTAAGAGAGGAATGTACACATGGGCAAGTATTTTGGAACAGACGG

[0063] glmM -R: C...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses recombinant bacillus subtilis for producing chondroitin and application of the recombinant bacillus subtilis, belonging to the technical field of biological engineering. According to the recombinant bacillus subtilis, UDP-GlcNAc C4 isomerase KfoA and chondroitin synthetase KfoC encoding genes are integrated into a bacillus subtilis genome, the way for anabolic synthesis of chondroitin is completed, the genes of the synthesis way of UDP-GlcA and UDP-GlcNAc in the bacillus subtilis are subjected to modulation assembling expression analysis, the different concentrations of UDP-GlcA and UDP-GlcNAc are controlled, and key genes and nodes of the synthesis way for producing chondroitin from bacillus subtilis are analyzed. Certain basis is provided for efficiently producing and preparing chondroitin from food-order microorganisms, and the recombinant bacillus subtilis is applicable to industrial production and application.

Description

technical field [0001] The invention relates to a chondroitin-producing recombinant Bacillus subtilis and its application, and belongs to the technical field of bioengineering. Background technique [0002] Chondroitin is a polysaccharide family of glycosaminoglycans (GAGs). Glycosaminoglycans are a class of unbranched, negatively charged polysaccharide chains composed of repeating disaccharide units. Due to their unique inflexible nature and high negative charge, GAGs exhibit a highly extended conformation that occupies Large spaces, absorb cations and water and form porous gels in the extracellular matrix, GAGs found in most animals help hydrate and expand tissue and enable the matrix to withstand compressive forces. Therefore, glycosaminoglycans constitute a class of compounds with great potential for therapeutic applications. Chondroitin is a disaccharide monomer with a structure of 4-GlcA-β-1,3-GalNAc-β-1 (GlcUA: glucuronic acid, GalNAc: acetylgalactosamine) linked by...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/21C12P19/26C12R1/125
CPCC12N1/20C12P19/26C12N1/205C12R2001/125
Inventor康振陈坚堵国成金鹏张琳培
OwnerJIANGNAN UNIV