Beech ssr1 marker, primer pair, preparation method and application thereof
A primer pair and beech technology, applied in biochemical equipment and methods, microbe determination/testing, DNA/RNA fragments, etc., can solve problems such as poor stability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0029] Extraction and enzyme digestion of total DNA from beech
[0030] Select young beech leaves and extract the nuclear genome by CTAB method; use EcoRV to digest at 37°C for 3 hours, and inactivate the endonuclease at 65°C for 20 minutes; the reaction system is 20 μL, including 2.0 μL of 10×Buffer, 1.0 μL of EcoRV endonuclease, 2 μL of DNA, 15.0 μL of sterilized double distilled water;
[0031] Connection of connector
[0032] Connect the beech genomic DNA digested with EcoRV in step to the upper and lower linkers (upper linker sequence GTAATACGACTCACTATAGGGCACGCGTGGTCGACGGCCCGGGCTGGT, sequence listing SEQ.ID.No.4; lower linker sequence ACCAGCCC-NH2, sequence listing SEQ.ID.No.5); The 60 μL ligation system contains 9 μL enzyme-digested beech genomic DNA, 100 pmol of the upper and lower adapters; the ligation reaction is carried out under the condition of 1 times T4 ligase buffer, and ligated overnight at 16°C; the ligated mixture is reacted at 65°C for 20 minutes to inac...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com