Unlock instant, AI-driven research and patent intelligence for your innovation.

Pichia stipitis gene expression system as well as construction and application thereof

A Pichia stipitis and expression system technology, applied in the direction of microorganism-based methods, using vectors to introduce foreign genetic material, microorganisms, etc., can solve problems such as the inability to meet the construction and application of high-efficiency expression vectors

Active Publication Date: 2015-05-06
JIANGNAN UNIV
View PDF0 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Currently, there are few available vector elements, such as promoters, screening markers, etc., which cannot satisfy the construction and application of high-efficiency expression vectors

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pichia stipitis gene expression system as well as construction and application thereof
  • Pichia stipitis gene expression system as well as construction and application thereof
  • Pichia stipitis gene expression system as well as construction and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0110] Example 1: Construction of PR series integrated expression vector

[0111] 1. Construction of recombinant plasmid pMD-18s rDNA

[0112] (1) According to the whole genome sequence of Spathaspora passalidarum (GenBank accession NZ_AEIK00000000), two primers were designed to intercept the partial sequence of Spathaspora passalidarum 18s rDNA as the homologous recombination site. The primer sequences are as follows: the underlined part of primer P1 is the recognition site of EcoR I, and the underlined part of primer P2 is the recognition site of Bgl II, BamH I and Kpn I from the 5' to 3' ends, respectively.

[0113] P1: 5'GCCG GAATTC TGCCAGTAGTCATATGCTTGTCTC3’

[0114] P2: 5'ATATTAGG GGTACC CG GGATCC GA AGATCT GTTGAAGAGCAATAAT3’

[0115] (2) Spathaspora passalidarum was cultured overnight, cells were collected, and genomic DNA was isolated and extracted.

[0116] (3) Using Spathaspora passalidarum genomic DNA as a template, PCR amplification was carried out with ...

Embodiment 2

[0175] Example 2: Construction of PA series integrated expression vector

[0176] 1. Construction of recombinant plasmid pMD-PsARS2

[0177] (1) Two primers, P19 and P20, were designed according to the DNA sequence of the autonomously replicating sequence of Pichia stipitis (GenBank accession U08628.1). The primer sequences are as follows: the underlined part of primer P33 is the recognition site of EcoR I, and the underlined part of primer P34 is the recognition site of Bgl II, BamH I and Kpn I from the 5' to 3' ends, respectively.

[0178] P33: 5'GCGCCG GAATTC AGTATAGGATATGGTGTTTAG 3’

[0179] P34: 5' ATTGG GGTACC CG GGATCC GA AGATCT TCTGCGGTGTC3’

[0180] (2) Pichia stipitis was cultured overnight, cells were collected, and genomic DNA was isolated and extracted.

[0181] (3) PCR amplification was carried out with primers P33 and P34 using the genome DNA of the host Pichia stipitis as a template. The amplification conditions were pre-denaturation at 95 °C for 5 ...

Embodiment 3

[0216] Example 3: Establishment of PEG / LiAc-mediated transformation of Pichia stipitis.

[0217] Taking Scheffersomyces stipitis NRRL Y-7124 as the host strain, the method for transforming yeast mediated by PEG / LiAc is implemented as follows:

[0218] 1. Preparation of Scheffersomyces stipitis NRRL Y-7124 competent

[0219] (1) Inoculate the Scheffersomyces stipitis NRRL Y-7124 stored in a cryopreservation tube into YPD medium, and activate and culture in a shake flask for 48 hours.

[0220] (2) The activated bacterial liquid was streaked on a YPD plate and stored at 4°C.

[0221] (3) A single colony of Scheffersomyces stipitis NRRL Y-7124 was picked from a YPD plate, inoculated into 20 ml of YPD medium, and cultured overnight at 30°C in a 100 ml shake flask.

[0222] (4) Inoculate the fresh bacterial liquid cultured overnight in 50 ml of YPD medium, and cultivate in a 250 ml shake flask at 30°C and 200 rpm until the bacterial liquid OD600 is about 1.2.

[0223] (5) Centrif...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a pichia stipitis gene expression system as well as construction and an application thereof. The pichia stipitis gene expression system comprises a novel expression vector which is of an annular structure; the following elements are operably connected from 5' to 3' sequentially: a pMD19-T simple plasmid skeleton, an rDNA homologous recombination sequence, an exogenous gene expression cassette and a selective marker gene expression cassette; from upstream side to downstream side, the exogenous gene expression cassette sequentially comprises a promoter, an exogenous gene insertion enzyme cutting site and a transcription terminator; the selective marker gene expression cassette comprises a promoter, an antibiotics resistance gene and a transcription terminator; and the yeast capable of making use of xylose is pichia stipitis. The expression vector disclosed by the invention can be used for achieving the integrated stable expression in the pichia stipitis; and the expression vector is of great significance for the basic theory research and product development of the pichia stipitis.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to an expression system of Pichia stipitis (Scheffersomyces stipitis) and a construction method and application thereof. Background technique [0002] With the continuous deepening of molecular biology theoretical research and the continuous innovation of molecular biology methods, genetic engineering technology has developed rapidly and achieved remarkable results. As an important part of genetic engineering technology, gene expression technology has penetrated into various fields of industry, agriculture and life sciences, and has been widely valued by people. According to the different hosts of exogenous gene expression, currently developed gene expression systems include Escherichia coli expression system, mammalian expression system, yeast expression system and so on. Among them, the yeast expression system has the advantages of simple operation, easy cultivation, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/81C12R1/84
Inventor 张梁范贺超高芝李由然石贵阳顾正华李赢丁重阳何冬旭
Owner JIANGNAN UNIV