Pichia stipitis gene expression system and its construction and application
A Pichia stipitis and expression system technology, applied in the direction of microorganism-based methods, using vectors to introduce foreign genetic material, microorganisms, etc., can solve problems such as the inability to meet the construction and application of high-efficiency expression vectors
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0111] Example 1: Construction of PR series integrated expression vectors
[0112] 1. Construction of recombinant plasmid pMD-18s rDNA
[0113] (1) According to the whole genome sequence of Spathaspora passalidarum (GenBank accession NZ_AEIK00000000), two primers were designed to intercept the partial sequence of Spathaspora passalidarum 18s rDNA as the homologous recombination site. The primer sequences are as follows: the underlined part of primer P1 is the recognition site of EcoR I, and the underlined part of primer P2 is the recognition site of Bgl II, BamH I and Kpn I respectively from the 5' to 3' ends.
[0114] P1: 5'GCCG GAATTC TGCCAGTAGTCATATGCTTGTCTC3'
[0115] P2: 5'ATATTAGG GGTACC CG GGATCC GA AGATCT GTTGAAGAGCAATAAT3'
[0116] (2) Cultivate Spathaspora passalidarum overnight, collect cells, separate and extract genomic DNA.
[0117] (3) Spathaspora passalidarum genomic DNA was used as a template, and PCR amplification was performed with primers P1 and ...
Embodiment 2
[0176] Example 2: Construction of PA series of integrated expression vectors
[0177] 1. Construction of recombinant plasmid pMD-PsARS2
[0178] (1) According to the DNA sequence of the self-replicating sequence of Pichia stipitis (GenBank accession U08628.1), two primers, P19 and P20, were designed. The primer sequences are as follows: the underlined part of primer P33 is the recognition site of EcoR I, and the underlined part of primer P34 is the recognition site of Bgl II, BamH I and Kpn I respectively from the 5' to 3' ends.
[0179] P33: 5'GCGCCG GAATTC AGTATAGGATATGGTGTTTAG 3’
[0180] P34: 5'ATTGG GGTACC CG GGATCC GA AGATCT TCTGCGGTGTC3'
[0181] (2) Cultivate Pichia stipitis overnight, collect cells, separate and extract genomic DNA.
[0182] (3) PCR amplification was performed with primers P33 and P34 using the genome DNA of the Pichia stipitis host strain as a template. The amplification conditions were pre-denaturation at 95°C for 5 min, denaturation at ...
Embodiment 3
[0217] Example 3: Establishment of PEG / LiAc-mediated transformation method of Pichia stipitis.
[0218] Using Scheffersomyces stipitis NRRL Y-7124 as the host bacterium, the method of transforming yeast mediated by PEG / LiAc is implemented as follows:
[0219] 1. Preparation of Scheffersomyces stipitis NRRL Y-7124 Competent State
[0220] (1) Inoculate the Scheffersomyces stipitis NRRL Y-7124 stored in the cryopreservation tube into the YPD medium, and activate the shake flask for 48 hours.
[0221] (2) Streak the activated bacterial solution on the YPD plate and store it at 4°C.
[0222] (3) Pick a single colony of Scheffersomyces stipitis NRRL Y-7124 from a YPD plate, inoculate it in 20 ml of YPD medium, and culture it overnight at 30° C. in a 100 ml shaker flask.
[0223] (4) Inoculate 50ml of YPD culture medium with the fresh bacterial solution cultivated overnight, and culture it in a 250ml shake flask at 30°C and 200rpm until the OD600 of the bacterial solution reaches ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



