Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

FDFT1 gene key loci affecting Chinese simmental cattle fat deposition

A Simmental cattle, fat deposition technology, applied in the field of cattle breeding for both meat and milk, to achieve the effect of low cost and high accuracy

Active Publication Date: 2015-05-13
JILIN UNIV
View PDF2 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, there is no report on the correlation between FDFT1 gene and cattle fat deposition, carcass composition and meat quality traits

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • FDFT1 gene key loci affecting Chinese simmental cattle fat deposition
  • FDFT1 gene key loci affecting Chinese simmental cattle fat deposition
  • FDFT1 gene key loci affecting Chinese simmental cattle fat deposition

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Obtaining bovine FDFT1 gene fragments and establishing a method for detecting polymorphisms in functional regions.

[0033] 1.1 Test materials: 449 28-month-old Chinese Ximenta bulls came from Baolongshan beef cattle fattening farm in Tongliao City, Inner Mongolia. Jugular vein blood collection, all blood samples were 10 mL / head, anticoagulated with ACD anticoagulant, and frozen at -20°C. Genomic DNA was extracted from blood samples using a genomic DNA extraction kit.

[0034] 1.2 Primer design and PCR amplification: Chinese Simmental cattle were selected as the test material, and the following 2 pairs of primers were designed according to the bovine FDFT1 gene sequence:

[0035] P1 forward primer F: 5'CCTGGAGGACTTCCCAACGGTAG 3',

[0036] P1 reverse primer R: 5'CCTGGAGAATGCTATGGACAGAGGG 3';

[0037] P2 forward primer F: 5' CTACTCGCCCATCTACCTGTCG 3',

[0038] P2 reverse primer R: 5' TCACACCTGCTACATTCAAGTCC 3';

[0039] PCR amplification was performed in the Chinese ...

Embodiment 2

[0045] Polymorphism distribution detection of genetic markers of FDFT1 gene obtained from screening in Chinese Simmental cattle population.

[0046] The polymorphism distribution frequency of exon 4 PCR-Hae-III-RFLP and exon 8 PCR-Hpa-II-RFLP of FDFT1 gene was detected in Chinese Simmental cattle population. The test results showed that among the three genotypes of SNP1 (I4-130 T>C), the proportion of wild-type TT individuals was higher. Although SNP2 (E8-500 C>T) is located in an exon, it does not encode a protein, but is located in a downstream regulatory region. Among the three genotypes of this SNP, the mutant homozygous individual TT genotype individuals are the least, and the wild type CC genotype individuals are the most distributed, which is dominant in the population, which is 0.66; the allele C frequency is 0.81, which is the dominant gene (Table 1 ).

[0047] Table 1. Gene frequency and genotype frequency of T130C intron region and C500T mutation site in exon re...

Embodiment 3

[0050] Association analysis and application of FDFT1 gene functional region genetic markers obtained from screening and fat deposition traits in Chinese Simmental cattle.

[0051] Trait Determination: Fat deposition and meat quality traits studied included carcass weight, slaughter percentage, kidney, kidney fat, genital fat, carcass length, carcass depth, carcass breast depth, ham girth, ham width, ham length, thigh meat Thickness, loin thickness, backfat thickness, fat coverage, marbling, eye muscle area, unsaturated fatty acid content in longissimus dorsi and longissimus muscles, etc. The determination of all characters is carried out according to the national standard GB / T1723821998.

[0052] In order to determine the correlation between the FDFT1 gene intron region T 130C and exon region C 500 T mutation sites and the fat deposition and meat quality traits of Chinese Simmental cattle, the Hae-III-RFLP established in Example 1 was used The polymorphism detection was carri...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an FDFT1 (farnesyl-diphosphate farnesyltransferase 1) gene key loci affecting Chinese simmental cattle fat deposition, and relates to a detection method for single-nucleotide polymorphism of Chinese simmental cattle fat deposition trait related FDFT1 gene. The method takes Chinese simmental cattle genomic DNA or a DNA sequence containing the Chinese simmental cattle FDFT1 gene as the template, and utilizes the PCR primer pair P1 and P2 to amplify a Chinese simmental cattle FDFT1 gene functional region fragment, and by means of sequencing screening, restriction endonuclease Hae-III and Hpa-II enzyme digestion, and electrophoretic analysis, the 130th SNP1 (T greater than C) of a 4th intron in the Chinese simmental cattle FDFT1 gene and the 500th SNP2 (C greater than T) of a 8th exon can be determined. In the screening obtained SNPs, the T allele and TT genotype of the SNP1 locus and the C allele and CC genotype of the SNP 2 locus can serve as the effective molecular genetic markers for significantly improving Chinese simmental cattle fat deposition and inter-muscular fatty acid traits so as to be used for beef cattle meat quality trait early marker assisted selection of molecular breeding.

Description

technical field [0001] The invention discloses a key site of the FDFT1 gene that affects the fat deposition of Chinese Simmental cattle, and relates to the single nucleotide polymorphism of the FDFT1 gene related to the fat deposition traits of Chinese Simmental cattle and its detection method and its use as an auxiliary selection marker in The application in the breeding of meat-milk dual-purpose cattle belongs to the technical field of meat-milk dual-purpose cattle breeding. Background technique [0002] Chinese Simmental is a large meat-milk dual-purpose breed that was independently bred in my country after it was introduced in the 1950s. Because of its uniqueness and good meat and milk production performance, it has been widely promoted in China's grasslands, plains, mountains and hills, and has shown its great advantages and development potential as a new breed of meat and milk cattle. It has become the most domestically raised cattle breed. , the most widely distribute...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/54C12Q1/68
Inventor 杨润军赵志辉梁晶婕房希碧龙小娟肖航姜平
Owner JILIN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com