FDFT1 gene key loci affecting Chinese simmental cattle fat deposition
A Simmental cattle, fat deposition technology, applied in the field of cattle breeding for both meat and milk, to achieve the effect of low cost and high accuracy
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] Obtaining bovine FDFT1 gene fragments and establishing a method for detecting polymorphisms in functional regions.
[0033] 1.1 Test materials: 449 28-month-old Chinese Ximenta bulls came from Baolongshan beef cattle fattening farm in Tongliao City, Inner Mongolia. Jugular vein blood collection, all blood samples were 10 mL / head, anticoagulated with ACD anticoagulant, and frozen at -20°C. Genomic DNA was extracted from blood samples using a genomic DNA extraction kit.
[0034] 1.2 Primer design and PCR amplification: Chinese Simmental cattle were selected as the test material, and the following 2 pairs of primers were designed according to the bovine FDFT1 gene sequence:
[0035] P1 forward primer F: 5'CCTGGAGGACTTCCCAACGGTAG 3',
[0036] P1 reverse primer R: 5'CCTGGAGAATGCTATGGACAGAGGG 3';
[0037] P2 forward primer F: 5' CTACTCGCCCATCTACCTGTCG 3',
[0038] P2 reverse primer R: 5' TCACACCTGCTACATTCAAGTCC 3';
[0039] PCR amplification was performed in the Chinese ...
Embodiment 2
[0045] Polymorphism distribution detection of genetic markers of FDFT1 gene obtained from screening in Chinese Simmental cattle population.
[0046] The polymorphism distribution frequency of exon 4 PCR-Hae-III-RFLP and exon 8 PCR-Hpa-II-RFLP of FDFT1 gene was detected in Chinese Simmental cattle population. The test results showed that among the three genotypes of SNP1 (I4-130 T>C), the proportion of wild-type TT individuals was higher. Although SNP2 (E8-500 C>T) is located in an exon, it does not encode a protein, but is located in a downstream regulatory region. Among the three genotypes of this SNP, the mutant homozygous individual TT genotype individuals are the least, and the wild type CC genotype individuals are the most distributed, which is dominant in the population, which is 0.66; the allele C frequency is 0.81, which is the dominant gene (Table 1 ).
[0047] Table 1. Gene frequency and genotype frequency of T130C intron region and C500T mutation site in exon re...
Embodiment 3
[0050] Association analysis and application of FDFT1 gene functional region genetic markers obtained from screening and fat deposition traits in Chinese Simmental cattle.
[0051] Trait Determination: Fat deposition and meat quality traits studied included carcass weight, slaughter percentage, kidney, kidney fat, genital fat, carcass length, carcass depth, carcass breast depth, ham girth, ham width, ham length, thigh meat Thickness, loin thickness, backfat thickness, fat coverage, marbling, eye muscle area, unsaturated fatty acid content in longissimus dorsi and longissimus muscles, etc. The determination of all characters is carried out according to the national standard GB / T1723821998.
[0052] In order to determine the correlation between the FDFT1 gene intron region T 130C and exon region C 500 T mutation sites and the fat deposition and meat quality traits of Chinese Simmental cattle, the Hae-III-RFLP established in Example 1 was used The polymorphism detection was carri...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
