Unlock instant, AI-driven research and patent intelligence for your innovation.

Rhdococcus erythropolis chitin deacetylase, and establishment method and application thereof

A technology of deacetylase and Rhodococcus erythropolis, applied in the field of genetic engineering, can solve problems such as polluting the environment, not being able to obtain quality, and consuming large and strong alkalis

Inactive Publication Date: 2015-06-03
INST OF OCEANOLOGY - CHINESE ACAD OF SCI
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] At present, the industrial production of chitosan generally adopts the strong alkali thermochemical method. There are many defects and deficiencies in the production of chitosan by this method, mainly including the following aspects: the production process consumes a lot of energy, consumes a large amount of strong alkali, and seriously pollutes the environment. , Chitosan with uniform quality and specific deacetylation degree cannot be obtained, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rhdococcus erythropolis chitin deacetylase, and establishment method and application thereof
  • Rhdococcus erythropolis chitin deacetylase, and establishment method and application thereof
  • Rhdococcus erythropolis chitin deacetylase, and establishment method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1: Cloning of Rhodococcus erythropolis chitin deacetylase gene

[0024] Primers were designed to amplify the chitin deacetylase (CDA) of R. erythropolis HG05 based on the sequence information annotated as chitin deacetylase (CDA) in the four R. erythropolis genome sequences provided by NCBI Gene. Primers are:

[0025] RhErCDA-dF: ATGGACCGCCGACGCTTCCTC

[0026] RhErCDA-dR: TCACGGCTTCAGATARACAT (R stands for A / G)

[0027] R. erythropolis HG05 was used as a template (R. erythropolis HG05 was Rhodococcus erythropolis), and the enzyme production conditions were optimized by using response surface analysis (Sun YY, Zhang JQ, Wu SJ, Wang SJ. Statistical optimization for production of chitin deacetylase from Rhodococcus erythropolis HG05. Carbohydrate Polymers, http: / / dx.doi.org / 10.1016 / j.carbpol.2013.11.010).).

[0028] The PCR reaction system is: template 1 μL; 5 μL 10×PCR buffer, 2 μL dNTP (10 mmol / L), 2 μL primer RhErCDA-dF (10 μmol / L), 2 μL primer RhErCDA-dR (1...

Embodiment 2

[0048] Embodiment 2: In vitro recombinant expression, isolation and purification, and biological activity analysis of the RhErCDA gene of Rhodococcus erythropolis.

[0049] In vitro recombinant construction method:

[0050] 1. Construct chitin deacetylase recombinant expression vector;

[0051] 2. Introducing the recombinant expression vector obtained in step 1) into the Escherichia coli host cell, performing induced expression, and obtaining the expression product;

[0052] 3. Separation and purification of the recombinant protein obtained in step 2), namely chitin deacetylase.

[0053] In step 1), the expression vector can be pCT7-CHISP6H.

[0054] In step 2), the host cell is Escherichia coli BL21(DE3).

[0055] In step 3), the separation and purification method can be metal ion affinity chromatography

[0056] Construction of recombinant expression vector pCT7-CHISP6H-RhErCDA

[0057] After online analysis (http: / / smart.embl-heidelberg.de / ) of the amino acid sequence ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a Rhdococcus erythropolis HG05 chitin deacetylase, and an expression gene and application thereof. The amino acid sequence of the Rhdococcus erythropolis chitin deacetylase (RhErCDA) is disclosed as SEQ ID NO.2; and the nucleotide sequence of the RhErCDA expression gene is disclosed as SEQ ID NO.1. The engineering strain established by the gene can efficiently secrete and express RhErCDA. Affinity chromatography one-step purification is performed to obtain the recombinant RhErCDA with bioactivity. The recombinant RhErCDA can degrade a solid plate using 4-nitracetanilide as a substrate to generate greenish yellow (4-nitroaniline). The cloning of the Rhdococcus erythropolis chitin deacetylase gene and the successful preparation of the recombinant protein with bioactivity have important theoretical meanings and practical meanings for deep development and high-value utilization of chitin resources.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and specifically relates to a chitin deacetylase of Rhodococcus erythroflates and its construction method and application. Background technique [0002] Chitin is a polymer composed of N-acetylglucosamine connected by β-1,4 glycosidic bonds. It is a very important class of natural polysaccharides, and its quantity is second only to the most abundant resource in the world. Cellulose, but its utilization value is higher than that of cellulose, is the second largest nitrogen-containing organic compound in nature, and is called the world's sixth vital element by European and American academic circles. Chitin exists in the shells of many arthropods such as shrimps and crabs; chitin is also abundant in the body surface and digestive tract of insects and animals. [0003] It is estimated that the amount of chitin biosynthesis in nature is more than 100 billion tons, and the amount of chitin...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/80C12N15/55C12N15/70C12P19/26C12R1/01
CPCC12N9/80C12P19/26
Inventor 张继泉孙玉英相建海
Owner INST OF OCEANOLOGY - CHINESE ACAD OF SCI