Rhdococcus erythropolis chitin deacetylase, and establishment method and application thereof
A technology of deacetylase and Rhodococcus erythropolis, applied in the field of genetic engineering, can solve problems such as polluting the environment, not being able to obtain quality, and consuming large and strong alkalis
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] Example 1: Cloning of Rhodococcus erythropolis chitin deacetylase gene
[0024] Primers were designed to amplify the chitin deacetylase (CDA) of R. erythropolis HG05 based on the sequence information annotated as chitin deacetylase (CDA) in the four R. erythropolis genome sequences provided by NCBI Gene. Primers are:
[0025] RhErCDA-dF: ATGGACCGCCGACGCTTCCTC
[0026] RhErCDA-dR: TCACGGCTTCAGATARACAT (R stands for A / G)
[0027] R. erythropolis HG05 was used as a template (R. erythropolis HG05 was Rhodococcus erythropolis), and the enzyme production conditions were optimized by using response surface analysis (Sun YY, Zhang JQ, Wu SJ, Wang SJ. Statistical optimization for production of chitin deacetylase from Rhodococcus erythropolis HG05. Carbohydrate Polymers, http: / / dx.doi.org / 10.1016 / j.carbpol.2013.11.010).).
[0028] The PCR reaction system is: template 1 μL; 5 μL 10×PCR buffer, 2 μL dNTP (10 mmol / L), 2 μL primer RhErCDA-dF (10 μmol / L), 2 μL primer RhErCDA-dR (1...
Embodiment 2
[0048] Embodiment 2: In vitro recombinant expression, isolation and purification, and biological activity analysis of the RhErCDA gene of Rhodococcus erythropolis.
[0049] In vitro recombinant construction method:
[0050] 1. Construct chitin deacetylase recombinant expression vector;
[0051] 2. Introducing the recombinant expression vector obtained in step 1) into the Escherichia coli host cell, performing induced expression, and obtaining the expression product;
[0052] 3. Separation and purification of the recombinant protein obtained in step 2), namely chitin deacetylase.
[0053] In step 1), the expression vector can be pCT7-CHISP6H.
[0054] In step 2), the host cell is Escherichia coli BL21(DE3).
[0055] In step 3), the separation and purification method can be metal ion affinity chromatography
[0056] Construction of recombinant expression vector pCT7-CHISP6H-RhErCDA
[0057] After online analysis (http: / / smart.embl-heidelberg.de / ) of the amino acid sequence ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 