Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Fusobacterium necrophorum recombinant hemagglutinin related outer membrane protein and preparation method thereof

A technology of Fusobacterium necrosis and outer membrane protein, applied in the field of genetic engineering, can solve the problem of inability to obtain the degree of purification

Active Publication Date: 2015-06-03
INST OF SPECIAL ANIMAL & PLANT SCI OF CAAS +1
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the partial nucleotide sequence of the hemagglutinin-related outer membrane protein gene of Fusobacterium necroptosis has been published in GenBank, but there are few studies on the whole genome of Fusobacterium necroptosis and other bacteria of the genus Clostridium, and there are still many genes including blood The complete nucleotide sequence of the lectin-associated outer membrane protein gene is unknown, so it is impossible to obtain recombinant hemagglutinin-associated outer membrane protein of Fusobacterium necroptosis with high degree of purification

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fusobacterium necrophorum recombinant hemagglutinin related outer membrane protein and preparation method thereof
  • Fusobacterium necrophorum recombinant hemagglutinin related outer membrane protein and preparation method thereof
  • Fusobacterium necrophorum recombinant hemagglutinin related outer membrane protein and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0082] Example 1 Cloning of Unknown Sequence of Fusobacterium Necroptosis Hemagglutinin-Related Outer Membrane Protein Gene

[0083] 1. Design and synthesis of primers

[0084] According to the partial nucleotide sequence of the hemagglutinin-associated outer membrane protein gene of Fusobacterium necroptosis (publication number AF529887.1) published in GenBank, six genes were designed to amplify the hemagglutinin-associated outer membrane protein gene of Fusobacterium necroptosis by using Primer Premier 5.0 The primers SP1, SP2, SP3, SP4, SP5 and SP6 with unknown sequences were designed according to the following principles: the primer length is 22-26 nt, the GC content is 45-55%, and the Tm value is 60-70°C. The primer sequences are shown in Table 1, and the above primers were synthesized by Sangon Bioengineering (Shanghai) Co., Ltd.

[0085] Table 1

[0086] Primer name Primer sequence 5'→3' SP1 GCCCCGACTTTGATGTTTCCACTACT SP2 GCGGGCGGTTCAAATGTTAC...

Embodiment 2

[0104] Example 2 Verification of the Unknown Sequence of Fusobacterium Necroptosis Hemagglutinin-Related Outer Membrane Protein Gene

[0105] 1. Design and synthesis of primers

[0106] According to the sequencing results of Example 1, Primer Premier 5.0 was used to design two primers j1 and j2 for verifying the unknown sequence of the Fusobacterium necroptosis hemagglutinin-related outer membrane protein gene obtained in Example 1. The primer sequences are shown in Table 6, The above primers were synthesized by Sangon Bioengineering (Shanghai) Co., Ltd.

[0107] Table 6

[0108] Primer name Primer sequence 5'→3' j1 TAGTCGAGTGAGATGAAGCAAGCGGAG j2 CCCGCCGAGTGAGATGAAACGAGTAC

[0109] 2. Verification of the unknown sequence at the 5' end of the hemagglutinin-related outer membrane protein gene of Fusobacterium necroptosis

[0110] The genomic DNA of FN (AB) was extracted using a bacterial genomic DNA extraction kit, and the extracted genomic DNA of FN...

Embodiment 3

[0119] Example 3 Segmental cloning of Fusobacterium necroptosis hemagglutinin-related outer membrane protein gene and construction of prokaryotic expression vector

[0120] 1. Design and synthesis of primers

[0121] According to the complete nucleotide sequence of the Fusobacterium necroptosis hemagglutinin-associated outer membrane protein gene obtained in Example 2 (as shown in sequence 6 in the sequence listing), utilize Primer Premier 5.0 to design three pairs for segmental amplification of necrosis The primers fP1 / rP1, fP2 / rP2, and fP3 / rP3 of the Fusobacterium hemagglutinin-related outer membrane protein gene were amplified in three sections that partially overlapped each other and covered the entire open reading frame of the Fusobacterium necrotic hemagglutinin-related outer membrane protein ( ORF) gene fragments p1, p2, p3, the nucleotide sequence of gene fragment p1 is as shown in sequence 8 in the sequence listing, the amino acid sequence of its encoding is as shown ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Apertureaaaaaaaaaa
Pitchaaaaaaaaaa
Login to View More

Abstract

The invention discloses a fusobacterium necrophorum recombinant hemagglutinin related outer membrane protein and preparation method thereof, and relates to the technical field of genetic engineering. The black of the fusobacterium necrophorum recombinant hemagglutinin related outer membrane protein is supplemented. A gene nucleotide sequence of the fusobacterium necrophorum recombinant hemagglutinin related outer membrane protein is represented by SEQ ID NO: 6 in a sequence table, the amino acid sequence is represented by the SEQ ID NO: 7 in the sequence table. The preparation method comprises the following steps: firstly obtaining a complete nucleotide sequence of the fusobacterium necrophorum recombinant hemagglutinin related outer membrane protein through a chromosome walking method, and obtaining the recombined fusobacterium necrophorum recombinant hemagglutinin related outer membrane protein through the genetic engineering method on that basis so as to provide basis for the subsequent related experiment. Through the adoption of a prokaryotic expression system, the fusobacterium necrophorum recombinant hemagglutinin related outer membrane protein is wide in application range, low in cost, high in expression amount, clear in research background, and mature in technical route; a plurality of commercial prokaryotic expression vectors and expression hosts can be selected.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a recombinant hemagglutinin-related outer membrane protein of Fusobacterium necroptosis and a preparation method thereof. Background technique [0002] Fusobacterium necroptosis is a strictly anaerobic Gram-negative polymorphic bacillus that is mainly distributed in the oral cavity, gastrointestinal tract and urogenital tract of humans and animals. It is an opportunistic pathogen that often causes acute and chronic throat infections in humans Lemierre's syndrome and foot rot and liver abscess in ruminants such as cattle, sheep, and deer are mostly chronic. If the treatment is not timely, it will cause symptoms such as abscess and necrosis in the animal's hoof, liver, kidney and other internal organs. Then it affects the production performance of animals and brings huge economic losses to the breeding industry. [0003] There are two main methods to obtain a specific ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/31C07K14/33C12N15/10C12N15/70C07K1/22C12R1/145
Inventor 陈立志吴洪超冯二凯刘晓颖彭风华程世鹏闫喜军吴威
Owner INST OF SPECIAL ANIMAL & PLANT SCI OF CAAS
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com