Fusobacterium necrophorum recombinant hemagglutinin related outer membrane protein and preparation method thereof
A technology of Fusobacterium necrosis and outer membrane protein, applied in the field of genetic engineering, can solve the problem of inability to obtain the degree of purification
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0082] Example 1 Cloning of Unknown Sequence of Fusobacterium Necroptosis Hemagglutinin-Related Outer Membrane Protein Gene
[0083] 1. Design and synthesis of primers
[0084] According to the partial nucleotide sequence of the hemagglutinin-associated outer membrane protein gene of Fusobacterium necroptosis (publication number AF529887.1) published in GenBank, six genes were designed to amplify the hemagglutinin-associated outer membrane protein gene of Fusobacterium necroptosis by using Primer Premier 5.0 The primers SP1, SP2, SP3, SP4, SP5 and SP6 with unknown sequences were designed according to the following principles: the primer length is 22-26 nt, the GC content is 45-55%, and the Tm value is 60-70°C. The primer sequences are shown in Table 1, and the above primers were synthesized by Sangon Bioengineering (Shanghai) Co., Ltd.
[0085] Table 1
[0086] Primer name Primer sequence 5'→3' SP1 GCCCCGACTTTGATGTTTCCACTACT SP2 GCGGGCGGTTCAAATGTTAC...
Embodiment 2
[0104] Example 2 Verification of the Unknown Sequence of Fusobacterium Necroptosis Hemagglutinin-Related Outer Membrane Protein Gene
[0105] 1. Design and synthesis of primers
[0106] According to the sequencing results of Example 1, Primer Premier 5.0 was used to design two primers j1 and j2 for verifying the unknown sequence of the Fusobacterium necroptosis hemagglutinin-related outer membrane protein gene obtained in Example 1. The primer sequences are shown in Table 6, The above primers were synthesized by Sangon Bioengineering (Shanghai) Co., Ltd.
[0107] Table 6
[0108] Primer name Primer sequence 5'→3' j1 TAGTCGAGTGAGATGAAGCAAGCGGAG j2 CCCGCCGAGTGAGATGAAACGAGTAC
[0109] 2. Verification of the unknown sequence at the 5' end of the hemagglutinin-related outer membrane protein gene of Fusobacterium necroptosis
[0110] The genomic DNA of FN (AB) was extracted using a bacterial genomic DNA extraction kit, and the extracted genomic DNA of FN...
Embodiment 3
[0119] Example 3 Segmental cloning of Fusobacterium necroptosis hemagglutinin-related outer membrane protein gene and construction of prokaryotic expression vector
[0120] 1. Design and synthesis of primers
[0121] According to the complete nucleotide sequence of the Fusobacterium necroptosis hemagglutinin-associated outer membrane protein gene obtained in Example 2 (as shown in sequence 6 in the sequence listing), utilize Primer Premier 5.0 to design three pairs for segmental amplification of necrosis The primers fP1 / rP1, fP2 / rP2, and fP3 / rP3 of the Fusobacterium hemagglutinin-related outer membrane protein gene were amplified in three sections that partially overlapped each other and covered the entire open reading frame of the Fusobacterium necrotic hemagglutinin-related outer membrane protein ( ORF) gene fragments p1, p2, p3, the nucleotide sequence of gene fragment p1 is as shown in sequence 8 in the sequence listing, the amino acid sequence of its encoding is as shown ...
PUM
Property | Measurement | Unit |
---|---|---|
Aperture | aaaaa | aaaaa |
Pitch | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap