Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

120 results about "Foot rot" patented technology

Foot rot, or infectious pododermatitis, is a hoof infection commonly found in sheep, goats, and cattle. As the name suggests, it rots away the foot of the animal, more specifically the area between the two toes of the affected animal. It is extremely painful and contagious. It can be treated with a series of medications, but if not treated, the whole herd can become infected. The cause of the infection in cattle is two species of anaerobic bacteria, Fusobacterium necrophorum and Bacteroides melaninogenicus. Both bacteria are common to the environment in which cattle live, and Fusobacterium is present in the rumen and fecal matter of the cattle. In sheep, F. necrophorum first invades the interdigital skin following damage to the skin, and causes interdigital lesions and slight inflammation. The second stage of the disease is marked by the invasion of the foot by the foot rot bacterium Dichelobacter nodosus, a Gram-negative anaerobe. Usually, an injury to the skin between the hooves allows the bacteria to infect the animal. Another cause of foot rot may be high temperatures or humidity, causing the skin between the hooves to crack and let the bacteria infect the foot. This is one of the reasons foot rot is such a major problem in the summer. Foot rot is easily identifiable by its appearance and foul odor. Treatment is usually with an antibiotic medication, and preventing injury to the feet is the best way to prevent foot rot.

Bacillusamyloliquefaciens strain and application thereof

InactiveCN1952116AStrong inhibitory activityBiocideBacteriaAlternaria tomatoMonomer
The invention relates to a strain of lys-starch bacillus as well its application. The bacterium is separated from the soil on eggplant fields, anning district, Lanzhou, Gansu. The bacterium is identified to be Bacillus amyloliquefaciens. It's preserved in the Chinese typical culture preserving center (CCTCC) with a preserving name of Bacillus amyloliquefaciens I7 and preserving code of M206027. The broth of M206027 and M206027strain, non-cell culture fluid of M206027 strain's broth, and the monomer extracted from the M206027strain, M206027 broth or its non-cell culture fluid can be used in the biological control of peach anthracnose bacterium, pear nigrities artis bacterium, apple brown rot bacterium, Fusarium acuminatum, Fusarium oxysporum, Fusarium semitectum, chilli black rot bacterium, cucumber blight bacterium, tomato early blight bacterium, eggplant early blight bacterium, dry thread Pyrenomycetes, wheat foot rot bacterium, potato thread Pyrenomycetes, potato early blight bacterium, potato late blight bacterium and watermelon downy mildew bacterium. It's easy to get the material of the invention and easy to operate; besides, it can be widely used in full scale production.
Owner:LANZHOU UNIVERSITY

Bacillus subtilis strain and application thereof

InactiveCN1952117AStrong inhibitory activityBiocideBacteriaAlternaria tomatoOrganism
The invention relates to a strain of Bacillus subtilis as well its application. The bacterium is separated from the soil on lily fields, fanjiaping, Lanzhou, Gansu. The bacterium is identified to be Bacillus-subtilis. It's preserved in the Chinese typical culture preserving center (CCTCC) with a preserving name of Bacillus-subtilis M22BH3 and preserving code of M206028. The broth of M22BH3 and M22BH3 strain, non-cell culture fluid of M22BH3 strain's broth, and the monomer extracted from the M22BH3 strain, M22BH3 broth or its non-cell culture fluid can be used in the biological control of peach anthracnose bacterium, pear nigrities artis bacterium, apple brown rot bacterium, Fusarium acuminatum, Fusarium oxysporum, Fusarium semitectum, chilli black rot bacterium, cucumber blight bacterium, tomato early blight bacterium, eggplant early blight bacterium, dry thread Pyrenomycetes, wheat foot rot bacterium, potato thread Pyrenomycetes, potato early blight bacterium, potato late blight bacterium and watermelon downy mildew bacterium. It's easy to get the material of the invention and easy to operate; besides, it can be widely used in full scale production.
Owner:LANZHOU UNIVERSITY

Nano-emulsion medicine for treating foot rot and preparation method thereof

The invention discloses a nano-emulsion medicine for treating foot rot. The grain diameter of the nano-emulsion is in a range of 1-100 nanometers and the nano-emulsion is composed of the following raw materials: 0.1-10.0% of pine tar, 0.1-6.0% of cinnamyl aldehyde, 0.1-6.0% of carvacrol, 0.1-5.0% of camphor oil, 0.01-0.1% of clobetasol propionate, 18.0-35.0% of surfactant, 0-7.0% of co-surfactant and residual amount of distilled water; and the sum of the mass percentages of the components is 100%. The nano-emulsion disclosed by the invention has the functions of dissolving cutin, relieving itching, diminishing inflammation, restraining, partially disinfecting and resisting corrosion, accelerating absorption and the like, and is mainly used for treating animal foot rot. According to the nano-emulsion medicine for treating the foot rot, the solubility of the medicine is increased, the medicinal stability and the biological utilization rate are improved, the dosage of the medicine is reduced, the skin transmission rate is higher than that of common preparations including a medicinal extract and the like, and the cost is low, so that the nano-emulsion medicine has a wide market prospect in a veterinary medicine field.
Owner:NORTHWEST A & F UNIV

Fusobacterium necrophorum vaccine and method for making such vaccine

The present invention relates to a method of producing a vaccine for the prevention of F. necrophorum bacterial infections, comprising isolating the F. necrophorum bacteria from a bovine species, growing the bacteria in a suitable growth medium for a period equal to between about 10 hours and about 18 hours so as to achieve a bacterial population equal to at least 1x105 CFU / ml, terminating the growth, and using a whole cell culture to form the vaccine. Additionally, the present invention relates to the vaccine comprised of a killed whole cell population of the F. necrophorum bacteria taken from a bovine. The present invention further relates to a method for preventing footrot and liver abscesses caused by F. necrophorum bacteria.
Owner:NOVARTIS ANIMAL HEALTH INC

Purple stem boneset extract for prevention and treatment of plant disease

InactiveCN1788570AGood control effectReduce the cost of prevention and treatmentBiocideDisinfectantsEUPATORIUM ExtractPathogenic bacteria
The present invention relates to plant disease prevention and control with plant extract, and is especially purplestem eupatorium extract for plant disease prevention and control. The n-hexane and petroleum ether extract of purplestem eupatorium has high inhibiting activity on the pathogenic bacteria causing foot rot of broad bean, early blight of tomato, rice blast and pear scab. The purplestem eupatorium extract may be used to prepare germicide with other natural plant extracts, and the germicide has excellent prevention and control effect on plant diseases. The present invention utilizes purplestem eupatorium extract in preventing and controlling plant diseases for the first time.
Owner:YUNNAN AGRICULTURAL UNIVERSITY

Preparation method of anti-oxidation and anti-pollution multi-nutrient block for dairy cows

The invention discloses a preparation method of an anti-oxidation and anti-pollution multi-nutrient block for dairy cows, belonging to the technical field of a block for the dairy cows. The method takes molasses, urea, vitamins and mineral elements as main raw materials; the anti-oxidation and anti-pollution multi-nutrient block is prepared by scientifically compounding natural antioxidant substances, Chinese herb extracts and seasoning extracts; the prepared multi-nutrient block for the dairy cows is moderate in hardness, dampproof, breakage-proof and high in weather fastness; the lapping surface of the block is low in bacterial content which is 1.5 per ten thousand of a comparison group; after the multi-nutrient block is used, the milk yield of the lactating dairy cows can be remarkably increased by 19.02%, the first estrus time is shortened by 13 days after parturition of the dairy cows, the conception rate of the dairy cows at the first estrus period is increased by 16.5% after parturition of the dairy cows, the oestrus proportion of the postpartum dairy cow group is increased by 18.4%, the feed intake and the immunity of the organism of the dairy cows can be effectively improved, the occurrence rates of nutritional diseases such as abnormal addiction disease, foot rot, white muscle disease, postpartum paralysis, rickets, mastitis, coarse fur and the like of the dairy cows can be remarkably reduced, and the occurrence rates are averagely reduced by 3.3-16.7%.
Owner:邵素英

Construction method of cast-in-situ bored pile suitable for karst cave geology

ActiveCN104818712AReduce segregationReduce rotten feetBulkheads/pilesKarstCave
The invention discloses a construction method of a cast-in-situ bored pile suitable for the karst cave geology. The construction method comprises the following steps that (1), a pile position is measured and positioned; (2), a casing is embedded; (3), a pile machine is in position; (4), rock blocks and yellow mud are backfilled, a hole is bored; (5) first-time hole cleaning is carried out; (6), a steel sleeve and a steel reinforcement cage are machined and fixed; (7), the steel sleeve and the steel reinforcement cage are put into the hole; (8), a guide pipe is arranged, and second-time hole cleaning is carried out; (9), concrete is poured; and (10), shifting is carried out. Compared with a conventional construction method, pile body segregation, foot rotting, pile breaking defects and the like are effectively solved, and pile waste can be prevented; the quality of a pile foundation is obviously improved, and safety of a foundation structure of a house is ensured; and later reinforcing or layer reduction event caused by insufficient bearing capacity of a foundation is avoided.
Owner:ZHEJIANG DAHUA CONSTR GROUP

Pesticide composition containing picoxystrobin and amides

ActiveCN102217610AReduce usageNot easy to transportBiocideFungicidesSnow moldHigh activity
The invention discloses a pesticide composition containing picoxystrobin and amides. The pesticide composition comprises an active component A and an active component B, wherein the active component A is selected from picoxystrobin; the active component B is selected from any one of the following bactericides: dimethomorph, metalaxyl, Metalaxyl-M, BENALAXYL, Benalaxyl-M, Flutolanil and Pyrimorph; and the weight percentage of A to B is 1%-80%:1%-80%. The composition can prevent and treat a plurality of crop diseases, has a notable synergetic action, enlarges the insecticidal spectrum, and is of high activity on downy mildew, epidemic disease, late blight, Leptosphaeria maculans, Pernophythora litchi, phytophthora, white rust, foot rot, Phytophthora parasitica, Pythium debaryanum, soft rot, damping off, banded sclerotial blight, snow mold, Leaf blight, Septoria nodorum, brown blotch or powdery mildew. The consumption of the pesticide is reduced, the residual quantity of the pesticide on crops is decreased and environmental pollution is abated.
Owner:陕西汤普森生物科技有限公司

Cultivation method of greenhouse eggplant

The invention discloses a cultivation method of a greenhouse eggplant, and relates to the technical field of eggplant planting. The method comprises the following steps of (1) vegetable field selection; (2) greenhouse building and soil preparation; (3) variety selection; (4) seed soaking and germination accelerating; (5) seedbed seedling; (6) transplanting and field planting; (7) field management; and (8) harvesting. The incidence rate of diseases and pests is effectively reduced, the greenhouse eggplant is free of a pesticide residue; the epidemic disease such as root rot and foot rot are not easily generated; the eggplant is smooth in surface, bright and clean in color and luster, pleasant in taste and high in nutrient value.
Owner:黄勇

Plant container

A plant container consisting of decayable and ecologically safe materials is collapsible and assembled from its parts consisting of a pre-cut casing (1) and a bottom (2) made of dimensionally stable wire mesh or biologically degradable plastic and a decayable organic material attached thereto. The plant container can be inexpensively transported and easily assembled just before it is put to use. It is permeable to water and air, prevents the accumulation of wetness, root rot and mildew, hinders the formation of spiraling roots and promotes a safe growth of the plant. The plant container is robust and dimensionally stable and therefore suited for use with planting machines.
Owner:STOEVER HERMANN

Method for ecological breeding of rice field polyculture carp

InactiveCN106342619AAvoid the phenomenon of hypoxic root rotAvoid pollutionClimate change adaptationAnimal feeding stuffPolycultureWater quality
The invention discloses a method for ecological breeding of rice field polyculture carp and relates to the technical field of agriculture. The method comprises a step (a) of field preparation; a step (b) of field transformation; a step (c) of rice planting; a step (d) of fry stocking; and a step (e) of feeding and management. By arrangement of a stocking area and a rice planting area which are separated, an organic fertilizer discharged in the stocking area by young ducks is effectively applied to the rice planting area through circulation of a water feeding pipe and a water discharging pipe. By application of the technical scheme, ammonia, nitrogen and phosphorus and the like which are decomposed in aquatic organisms and duck excrement and residue in complex planting and breeding can be neutralized, rice hypoxia and foot rot caused by water quality pollution are avoided, and the comprehensive production capacity of a rice field is improved.
Owner:贵州山至金生态农业有限公司

Pseudomonas for bacterial disease control and application

The invention belongs to the technical field of biology and provides a pseudomonas for bacterial disease control and an application. A microorganism with bacteriostatic activity on phytopathogenic bacteria is separated from peanut foot rot soil; and a pseudomonas bacterium is determined according to 16S rRNA and a whole genome sequence. By adopting a bacteria solution root-irrigation method, tomato bacterial wilt can be effectively inhibited. The pseudomonas can be used for green biological control of the phytopathogenic bacteria.
Owner:FUJIAN AGRI & FORESTRY UNIV

Seed coating agent for controlling soya foot rot and preparation method thereof

InactiveCN101422159AEfficient in disease controlGood effectBiocideFungicidesAdditive ingredientDisinfectant
The invention provides a seed coating which can control root rot of soy beans and a preparation method thereof. The seed coating comprises a disinfectant and an accessory ingredient which can control root rot of soy beans. The material components are as follows: dimethomorph thiram, hymexazol, a film forming agent, a thickening agent, a warn color, foam killer and water which are prepared according to the following steps in turn: the original drugs of the thickening agent, the dimethomorph, the thiram and the hymexazol are added into proper amount of water, ground and stirred for 1.5 to 2 hours and fully mixed; then the film forming agent and the warn color are added and fully stirred and mixed for 1 to 2 hours; finally the foam killer is added for killing foams; and a finished product isobtained if the detection is qualified. The seed coating does not have harmful effects on the emergence of seedlings and growing of the beans, can control the Phytophthora root rot of the soy beans and the fusarium root rot of the soy beans; the control effect of the seed coating is between 80.2 and 85.7 percent; moreover, the seed coating does not have harmful effects to the growing of the soya beans and can remarkably improve the yield of the soy beans.
Owner:INST OF PLANT PROTECTION FAAS

Angelica sinensis cultivation method

The invention discloses an angelica sinensis cultivation method. The method comprises the following steps of managing a seed bed, broadcasting seeds and nursing, managing seed nursery, selecting a big field transplantation land, tidying the big field transplantation land, transplanting to the large field, managing a growth period, preventing plant diseases and pests, harvesting, processing and reserving seeds. Soil and faeces are laid on the surface layer of the seed bed; various farm manure and soil modifier are added to improve soil loosening degree and water permeability; smoked manure is applied before deep tilliage on the transplantation land; the smoked manure can adjust soil acid-base value and supply potassic fertilizer and phosphatic fertilizer; seeds are dried, rubbed and immersed into pesticide before nursery to improve seed germination rate and reduce pest disease possibility; little medicine residue amount and little pollution are achieved; accumulated water can be eliminated in time in rainy seasons to prevent foot rotting; and bolting and yellow leaves are eliminated in time to guarantee angelica sinensis quality and output. By the use of the angelica sinensis cultivation method, angelica sinensis has high output per mu, great quality and little pest diseases; great foundation is laid for angelica sinensis artificial large-scale plantation and angelica sinensis product competitiveness increase; and the angelica sinensis cultivation method has great economic, social and ecological benefits.
Owner:TONGCHENG TAIAN CHINESE HERBAL MEDICINE PLANTING PROFESSIONAL COOP

Technology for preventing and curing root rot and stem rot of peanut

InactiveCN103385085ASolve the way of disease transmissionGrow fastPlant protectionContinuous croppingPlant disease
The invention aims at solving the problems that the root rot and the stem rot of the peanut seriously happen on the continuous cropping land parcels; the peanut is weak in growth, bad in disease resistance and serious in morbidity in the land which is shallow in soil layer, arenaceous and low in fertility; the spring-sown peanut is serious in morbidity of root rot on the early-sown land parcels; and the root rot is serious in the year which is overcast and rainy, and high in humidity during seedling stage, the root disease, the stem disease and the fruit disease of the mulching film peanut commonly happen, wherein the common disease incidence reaches 3%-15%, 80% seriously and the like. According to the technical effect of the invention, the disease propagation spreading paths such as the facts that the soil carries disease germs, the seed carries disease germs and the manure carries disease germs can be solved, the peanut growth vigor can be improved, and the disease resistance can be improved.
Owner:韩浩良

Oil emulsion vaccine for cattle and sheep foot rot and preparation method thereof

The invention provides an oil emulsion vaccine for cattle and sheep foot rot and a preparation method thereof. The oil emulsion vaccine is prepared from an oil phase and a water phase in parts by weight of (1.5-3):1 by adding a 0.01% thimerosal solution, wherein the oil phase is prepared from autoclaved medicinal white oil, 10% Span-80 white oil mixed liquor and 10% mannitol monooleate white oil mixed liquor according to the ratio of (1.8-2.2):1:1; the water phase is prepared by dissolving 4-7% sucrose ester into a water solution containing 10% tween-80 and 10% polyoxyethylene castor oil derivatives and then mixing with an antigen solution according to the ratio of 1:(2.5-3); and the antigen solution is a bacterial solution obtained by carrying out subculture on fusobacterium necrophorum through a fusobacterium necrophorum subculture medium, carrying out amplification culture through a fusobacterium necrophorum amplification culture medium and then carrying out concentration and inactivation, wherein the bacterial count of the bacterial solution per milliliter is not lower than 4*10<10> CFU. The invention also provides the preparation method of the oil emulsion vaccine. The oil emulsion vaccine provided by the invention has the characteristics of low viscosity, good stability, good immune effect, small clinical adverse reaction and low cost.
Owner:SICHUAN ANIMAL SCI ACAD

Pseudomonas putida BC10 and application thereof in controlling bacterial soft rot of crops

The invention discloses a strain of Pseudomonas putida BC10 and application thereof in controlling bacterial soft rot of crops. The strain was collected in the Guangdong Microbiological Culture Collection Center on July 10, 2018, and the collection number is GDMC NO.60411. The strain has a remarkable inhibitory effect on various bacterial diseases, especially has a good inhibitory effect on rice bacterial foot rot, bacterial soft rot pathogens of banana and soft rot pathogens of kaffir lily, can reduce bacterial soft rot of crops, and has a good control effect in pot experiments. The strain BC10 has no pathogenicity itself. It shows that the strain can be used for developing biopesticides for bacterial diseases of crops.
Owner:SOUTH CHINA AGRI UNIV

Granule bactericidal composition containing amino-oligosaccharin and hymexazol

InactiveCN107439564AGood control effectImprove securityBiocideFungicidesDiseaseInsecticide resistance
The invention discloses a granule bactericidal composition containing amino-oligosaccharin and hymexazol. The granule bactericidal composition comprises an effective component A amino-oligosaccharin and an effective component B hymexazol, with the mass ratio being 2:1 to 1:10, and preferably the mass ratio being 1:2 to 1:5. The bactericidal composition has an obvious synergetic effect, can reduce the consumption of pesticides, the residual amount of pesticides on crops and the environmental pollution, is safe for people and livestock, good in environmental compatibility, and ensures that diseases are not easy to develop insecticide resistance. The bactericidal composition has the purpose of preventing and treating soil-borne diseases, and has obvious control effects on foot rot and blight.
Owner:王章修

Method for preventing and treating root rot of large cherry trees

InactiveCN106034860AControl and improvementControl and improve transmissionCultivating equipmentsPlant protectionFruit treeTreatment effect
The invention discloses a method for preventing and treating root rot of large cherry trees. The method is characterized in that 14.5% diludine soluble powder, a Medina soil activator, humic acid and a rooting agent are used for preventing and treating fusarium of the large cherry trees in fields. According to the method disclosed by the invention, double treatment and management are performed on fruit trees and soil, so that favorable treatment effects are obtained, the occurrence and the propagation of the root rot of the large cherry trees are effectively controlled and alleviated, besides, the development and the growth of root systems of the large cherry trees can be effectively promoted, and besides, the preventing and treating method is simple, environmentally-friendly and suitable for large-area popularization.
Owner:JURONG XINCHENG FRUIT IND FAMILY FARM

Temperature-sensitive trichoderma harzianum microbial agent carrier formula and preparation process thereof

The invention relates to the technical field of biology and particularly relates to a temperature-sensitive trichoderma harzianum microbial agent carrier formula and a preparation process thereof. The temperature-sensitive trichoderma harzianum microbial agent carrier formula is characterized by being composed of the following raw materials in percentage by weight: 35%-45% of organic matter decomposed coal, 25%-35% of humic acid, 15%-25% of trichoderma harzianum fermented raw liquid and 5%-15% of diatomite. Compared with the prior art, a biological probiotic can be applied to various facilities including outdoor cultivation, greenhouse cultivation and the like, can be used for repairing soil and preventing soil-borne diseases, such as stem rot, wilt, damping-off, stalk break, rhizoctonia solani and root rots of various vegetables, grain crops, fruits, medicinal materials, flowers, nursery-grown plants and the like; microbes such as trichoderma harzianum and pathogenic bacteria interact; essentially, three organisms including trichoderma harzianum, plants and pathogenic bacteria interact.
Owner:上海大井生物工程有限公司

Method for treating citrus foot rots

InactiveCN105830826ARemove diseased areaImprove fertilityHorticulture methodsPlant protectionFruit treeCure rate
This patent belongs to the field of fruit tree planting, and specifically discloses a method for treating citrus foot rot, including the steps of dispensing, pretreatment, prespraying, ultraviolet irradiation, drug application, bandaging and soil covering. The method overcomes the technical problems of multiple application of pesticides and low cure rate in the traditional technology, and the citrus foot rot can be cured at one time by applying the invention, saving time and effort.
Owner:重庆市璧山区渝璧玉血橙种植股份合作社

Medicine for treating animal traumatic infection diseases

The invention aims to provide a medicine for treating animal traumatic infection diseases, which is formed by drug matching. The medicine is characterized by being prepared from following raw material medicines of leeches, mustards, all grass of highstalk razorsedge, fragile blueberry leaves, root of woody hawkbeard, tongking pepper, zanthoxylum nitidum DC, winged euonymus twig, corydalis bungeana, concha haliotidis, lygodium japonicum, golden-rod, polygonum aviculare, phoenix-tail fern, Indian nightshade root, lithargite, root of heartleaf viburnum, Chinese actinidia root, cayenne pepper and lysimachia christinae hance. The medicine mainly has the effects of inhibiting bacteria and resisting infection, removing blood and removing stasis, relieving swelling and pain, detoxifying and healing sores, removing the necrotic tissue and promoting granulation and promoting wounds to be healed. With the regard to external wound infection caused by various reasons of animals, such as knife wounds, bite wounds, cellulitis, dog anal gland abscess, gullet fistula, cow foot rot, parotid gland abscess, body surface ulcer, muscle rot, and old and difficultly-healed wounds, the medicine has the very obvious curative effect.
Owner:QINGDAO AGRI UNIV

Special amplimer for detecting tibetan sheep foot rot resistance allele, detecting agent case and method thereof

The invention mainly relates to a sheep molecular marker assistant breeding technique in the animal biotechnology, in particularly detecting tibetan sheep foot rot resistance allele. The invention provides a special amplimer for detecting tibetan sheep foot rot resistance allele which has characteristic that a first group amplimer has upstream length with 24bp ribonucleotide and downstream length with 22bp ribonucleotide, a second group amplimer has upstream length with 23bp ribonucleotide and downstream length with 24bp ribonucleotide, the upsteam amplimer 24bp: DQA2-up: CACATGTTACAGTGCAAAARCAGC; the downstream amplimer 22bp: DQA2-dn: CCCTCYCACCAACGTTTCCCAG; the upstream amplimer 23bp: DQA2s-up: ACTACCAATCTCATGGTCCCTCT; the downstream amlimer 24bp: DQA2S-dn: GGAGTAGAATGGTGGACACTTACC. The amplimwe has advantages of rapid, high sensitivity and low cost to molecular marker breed selection of the tibetan sheep foot rot.
Owner:GANSU AGRI UNIV

Trichoderma capable of preventing and treating root rot of loquat

The invention discloses trichoderma capable of preventing and treating root rot of a loquat and belongs to the technical field of microorganisms. Preservation number of the trichoderma capable of preventing and treating the root rot of the loquat is CGMCC No.9390. The trichoderma has a strong antagonistic effect on pathogenic bacteria of the root rot of the loquat and can be used for preventing and treating the root rot of the loquat, and indoor inhibition ratio reaches up to 88%. A method for preventing and treating the root rot of the loquat by adopting the trichoderma comprises the following steps: culturing the trichoderma on a solid culture medium, punching a bacterium cake for later use by adopting a puncher, punching a hole in the phloem of a trunk of a loquat seedling by adopting the puncher in the same specification at the same time, and removing the phloem; placing the bacterium cake into the hole in the trunk, the phloem of which is removed, of the loquat, and sealing with a preservative film for moisturizing; or culturing the trichoderma in a liquid culture medium, diluting a bacterium solution with sterilize water, and irrigating each loquat for 500ml diluent at roots. The trichoderma disclosed by the invention can be used for effectively preventing and treating the root rot of the loquat, a prevention and control method is simple, the environment is not polluted, and growth of the loquat can be promoted.
Owner:HONGHE COLLEGE

Application of GmPGIP3 protein and coding gene thereof to cultivation of plant for resisting root rot and full rot

The invention discloses application of GmPGIP3 protein and coding gene thereof to cultivation of a plant for resisting root rot and full rot. According to the method provided by the invention, a transgenic plant with the disease resistance higher than that of a target plant is obtained by transferring the coding gene of the GmPGIP3 protein into a target plant; the GmPGIP3 protein is shown as the following (a) or (b): (a) the protein consists of the amino acid sequence shown as the sequence 1 in the sequence table; and (b) the protein related to the plant disease resistance is obtained by replacing and / or deleting and / or adding one or more amino acid residues on the amino acid sequence shown as the sequence 1 and is derived from the sequence 1. The inventor establishes a monocotyledon high expression vector of the coding gene of the GmPGIP3 protein and transfers into wheat to obtain transgenic wheat capable of resisting root rot and full rot. The invention has important value on the breeding of the disease-resistant plants.
Owner:INST OF CROP SCI CHINESE ACAD OF AGRI SCI

Preparation method of microbial organic fertilizer capable of preventing and treating root rot of crops

The invention discloses a preparation method of a microbial organic fertilizer capable of preventing and treating root rot of crops, and relates to a production method of an organic biofertilizer, and belongs to the technical field of fertilizers. The method comprises the following steps of: first, preparing a culture seed liquid which prevents and treats root rot by a liquid fermental cultivation method; performing compost treatment for fresh excrement with moisture content of 70-75%, 10-20% bamboo vinegar stoste and 10-20% stopping mixed in a compost groove; adequately mixing a matrix after fermental cultivation with a pig manure compost product by volume ratio of 1:3-5; and preparing the biological organic fertilizer which can prevent and treat culture of root rot. The fertilizer has the beneficial effects that the fertilizer can effectively prevent and treat root rot, and organic solid waste can be recycled by using household garbage as well as pig, cattle, sheep manures and the like.
Owner:龚晓军

Specific primer used for analysis of diversity of pathogenic fungi causing root rot of soybean

ActiveCN103409532ADiversity analysis is accurateIntuitive test resultsMicrobiological testing/measurementMicroorganism based processesMicroorganismNucleotide sequencing
The invention discloses a specific primer used for analysis of diversity of pathogenic fungi causing root rot of soybean, which relates to a specific primer used for analysis of diversity of pathogenic fungi. The nucleotide sequence of the specific primer is 5'-CGTTGGGTTATTCCCCGGC-3'. The specific primer provided by the invention has the advantages of accurate analysis of diversity, visual, rapid and reliable detection results, etc. and can be applied in the field of microbiological detection.
Owner:黑龙江禾家福农业科技有限公司

Method for preventing root rot of rhubarb

The invention discloses a method for preventing root rot of rhubarb, which comprises the following steps: a. selection of seeding soil for crop rotation: wherein the period of crop-rotation is 4-6 years; b. soil treatment before seedling raising: in 7-10 days before seeding, mixing 1 portion of 50% carbendazol wettable powder and 30 portions of fine sand soil into bactericide sand soil, and applying the bactericide sand soil into a soil layer of 0-10 cm under the seedling raising field, wherein the application amount of the 50% carbendazol wettable powder is 6-10 kg / hm<2>; c. seed treatment before planting: in one day before planting, treating rhubarb seeds with a bactericide liquid prepared from water and the 50% carbendazol wettable powder according to 1000:1, covering with a plastic film to carry out pile fermentation for 10-15 hours, and then seeding, wherein the dose of the bactericide liquid is 5-6% of the amount of the seeds; d. elimination of diseased seedlings: lifting the seedlings in the next spring, wherein the seedlings is transplanted in the lifting process; and selecting non-diseased seedlings, and eliminating all the diseased seedlings; e. seedling dipping before transplanting: before transplanting, preparing a bactericide liquid from water and the 50% carbendazol wettable powder according to 1000-1500:1, keeping rhubarb germchit roots in the bactericide liquid for 3 minute, and immediately transplant; and f. soil treatment during transplanting: during transplanting, mixing 1 portion of 50% carbendazol wettable powder and 30 portions of fine sand soil into bactericide sand soil, and applying the bactericide sand soil into pits, wherein the application amount of the 50% carbendazol wettable powder is 7-11 kg / hm<2>.
Owner:GANSU AGRI UNIV

Bacillus amyloliquefaciens, fermentation product and preparation methods and application of bacillus amyloliquefaciens and fermetation product

The invention discloses bacillus amyloliquefaciens, a fermentation product and a preparation methods and application of bacillus amyloliquefaciens and fermetation product. The strain is named as the bacillus amyloliquefaciens E3, is preserved in China Center for Type Culture Collection (CCTCC) of Wuhan University, Wuhan, China on December 7, 2017, and has a preservation number of CCTCC NO: M 2017768; the strain can be used for effectively inhibiting infection of rice foot rot pathogenic bacteria on rice seeds, so that the germination rate is improved and the strain can be used as biocontrol bacteria to be applied to prevention and control of rice foot rot. The invention further provides a preparation method of a fermentation raw solution of the strain; the preparation method is simple andeasy to operate. The invention further provides antibacterial lipopeptide of the strain and an extraction method of the strain; the antibacterial lipopeptide has an inhibition effect on various plantpathogenic bacteria and has a wide bacterium inhibition spectrum, and can be used for developing an efficient, broad-spectrum, low-toxin and environment-friendly microorganism bacterium agent.
Owner:SOUTH CHINA AGRI UNIV