Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Modified bcg strains with reduced or eliminated activity of lsr2 and pharmaceutical composition comprising same

A composition and strain technology, applied in the field of tuberculosis vaccine, can solve the problem of insufficient immunogenicity and other problems

Inactive Publication Date: 2015-06-03
CHENGDU YONGAN PHARMA CO LTD +1
View PDF6 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to excessive in vitro passages (more than 1600 for some strains), it is thought that current BCG strains may have been too attenuated to be sufficiently immunogenic to confer effective protection (15)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Modified bcg strains with reduced or eliminated activity of lsr2 and pharmaceutical composition comprising same
  • Modified bcg strains with reduced or eliminated activity of lsr2 and pharmaceutical composition comprising same
  • Modified bcg strains with reduced or eliminated activity of lsr2 and pharmaceutical composition comprising same

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0045] The preparation of live recombinant vaccines is known to those skilled in the art. Typically, such vaccines are prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for solution, or suspension, in liquid prior to injection may also be prepared. The preparation can also be emulsification, or encapsulation of the protein into liposomes. The live immunogenic ingredient is usually mixed with excipients which are pharmaceutically acceptable and compatible with the active ingredient. Suitable excipients are, for example, water, saline, dextrose, glycerol, ethanol, etc. or combinations thereof. Furthermore, if desired, the vaccine may contain minor amounts of auxiliary substances, such as wetting or emulsifying agents, pH buffers and / or adjuvants which increase the efficacy of the vaccine. Examples of potentially effective adjuvants include, but are not limited to: aluminum hydroxide, N-acetyl-muramoyl-L-threonyl-D-isoglutamine (thr-MDP), ...

Embodiment 1

[0056] Embodiment 1: Construction of the lsr2 deletion mutant of M.tb and BCG

[0057] M.tb H37Rv (a laboratory virulent strain of M.tb purchased from ATCC, ATCC No. 25618) and BCG-Japan (30) (a gift from Marcel Behr) were generated by using a temperature-sensitive transducing phage system (26) The lsr2 deletion mutant, the main step in figure 2 shown in . DNA manipulations were performed essentially as described by Sambrook et al. (Sambrook, J., E.F. Fritsch and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.). Plasmid p0004 is a Hyg R - A counter-selectable suicide vector for the sacB cassette (31). An upstream left fragment (L-fragment) and a downstream right fragment (R-fragment) flanking the lsr2 gene were generated by two primer pairs. Using primer pair L-forward SEQ ID NO: 3 (CGGCTT CCATAAATTGG GCAGCTGGATCACCTGCTGGCGCAC) and L-reverse SEQ ID NO:4 (CGGCTT CCATTTTCTTGG CATTTGGCTACCGGCGCCCAG...

Embodiment 2

[0058] Example 2: Confirmation of the deletion of the lsr2 gene from M.tb H37Rv and BCG-Japan

[0059] Three clones of each strain (M.tb H37Rv and BCG-Japan) emerging after 4 weeks of the above experiments were randomly picked and grown in 20 ml of 7H9 medium containing 10% ADC for 4 weeks at 37°C. To isolate chromosomal DNA, 10 mL of each culture was centrifuged at 2,000×g for 20 minutes, and the pellet was washed with 1 ml of GTE solution (25 mM Tris-HCl pH 8.0, 10 mM EDTA, 50 mM glucose) and resuspended in 450 μl of GTE solution. 50 μl of lysozyme solution (10 mg / ml in Tris pH 8.5) was added, mixed gently, and incubated overnight at 37°C. Then 100 μl of 10% SDS and 50 μl of 10 mg / ml proteinase K (Sigma) were added, mixed gently, and incubated at 55° C. for 40 minutes. Then 200 μl of 5M NaCl and 160 μl of CTAB were added, mixed gently, and incubated at 65 °C for 10 min. An equal volume (≈1 ml) of chloroform:isoamyl alcohol (24:1) was added to the tube, and the aqueous phas...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a live modified Mycobacterium bovis�BCG strain in which the lsr2 gene is inactivated or its expression is reduced and a pharmaceutical composition comprising the same for the treatment or prophylaxis of a mammal against challenge by mycobacteria or against cancer. The invention further discloses a method for the treatment or prophylaxis of a mammal against challenge by Mycobacterium tuberculosis or Mycobacterium bovis or against cancer by administering to the mammal the live modified Mycobacterium bovis�BCG strain or the pharmaceutical composition of the present invention.

Description

technical field [0001] The present invention relates to tuberculosis (TB) vaccines. Specifically, the present invention provides an improved Bacillus Calmette-Guerin (BCG) strain, wherein the lsr2 gene is knocked out or its expression level is reduced. Background technique [0002] Tuberculosis (TB), caused by Mycobacterium tuberculosis (M.tb), is a global health threat. The latest surveillance data provided by the World Health Organization (WHO) shows that in 2010, there were 8.8 million new cases and 1.4 million deaths from TB. Successful global TB control faces many obstacles, including the difficulty of timely diagnosis, the lack of an effective vaccine, and the fact that the treatment requires many months of chemotherapy. The above situation has been further complicated by the emergence of M.tb / HIV co-infection and the occurrence of multidrug resistant (MDR) and broadly drug resistant (XDR) TB. Due to these circumstances, there is an urgent need for effective ways of...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/09C12N1/21C12N15/31C12R1/32
CPCA61K39/04C07K14/35C12N1/36A61K2039/522C12N1/20C12N15/74A61K2039/585
Inventor 刘军
Owner CHENGDU YONGAN PHARMA CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com