Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Nucleic acid aptamer combined with hepatitis delta virus and application thereof

A hepatitis D virus technology, applied in the field of genetic engineering and biomedicine, can solve the problem of lack of long-term effective antiviral drugs for HDV chronic infection, and achieve the effect of simple method and low cost

Inactive Publication Date: 2015-06-10
刘红卫
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the planned immunization of hepatitis D vaccine in China has greatly reduced the incidence of hepatitis D, there is still a lack of long-term effective antiviral drugs for the existing chronic HDV infection, and most drugs do not specifically act on the liver

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nucleic acid aptamer combined with hepatitis delta virus and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment I

[0019] Example 1 HiAg protein specifically binds to the SELEX screening of RNA aptamers

[0020] A conventional method for expressing hepatitis D protein in the art was adopted. According to the extracted hepatitis D virus, the RNA was extracted, and the full-length cDNA was obtained by RT-PCR and PCR. The hepatitis D virus protein was expressed in vitro by yeast expression method, and the corresponding protein was obtained, which was named HiAg.

[0021] Chemically synthesize the initial oligonucleotide random library and primers, the sequence is as follows: (5′-AGT CGA CCT TGC AAT GAG TGA----N37----CGC ATG GAA TTT GCA ACT GCC-3′), where N37 is 37 random oligonucleotides;

[0022] Primer P1: AGTCGACCTTGCAATGAGTGA;

[0023] Primer P2: GGCAGTTGCAAATTCCATGCG.

[0024] The single-stranded DNA library was amplified into double-stranded DNA, and the product was subjected to 2% agarose gel electrophoresis and then gel-cut to recover and purify; the recovered double-stranded DNA...

Embodiment 2

[0025] Example 2 Obtainment of HiAg-binding gametes with specificity and high affinity

[0026] 1.5 μg of the RNA aptamers were digested with calf intestinal alkaline phosphatase (CIP) at 37°C for 1 h, and the dephosphorylated RNA was purified and recovered; labeled with [γ-32P]ATP by T4 polynucleotide kinase on dephosphorylated Phosphorylated ends of RNA molecules. 10nmol radioactively labeled RNA aptamers were incubated with different concentrations (1-200nM) of HiAg at 37°C for 30min, each group of reaction solution was filtered through a nitrocellulose membrane, the filter membrane was washed, dried, and determined by a liquid scintillation counter The amount of radioactivity remaining on the filter membrane was measured twice in parallel on the same sample. Dissociation constants for each aptamer with HiAg were calculated. The result is as follows:

[0027]

Embodiment 3

[0028] Example 3 The aptamer specificity analysis and stability analysis

[0029] Hepatitis A virus, hepatitis B virus, hepatitis C virus, human serum albumin, and 10 aptamers were used for specific detection. After binding tests, it was found that these aptamers were not compatible with these viruses or Binding to human hemoglobin, while only binding to hepatitis D virus maintains a high specificity.

[0030] 0.1 ug of the aptamer was taken and placed in normal temperature serum and aqueous solution for two weeks. Through RT-PCR detection, it was found that its structure was stable and not degraded after two weeks of placement.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a nucleic acid aptamer targeted to the human-infected hepatitis delta virus and the sequence thereof and belongs to the field of genetic engineering and biological medicine. The new combinatorial chemistry technology SELEX is adopted, hepatitis delta virus protein serves as target protein, and the RNA aptamer capable of being combined with hepatitis delta virus surface antigen in a specific mode is screened out from a single-chain RNA random library. A special stem-loop structure can be formed by the aptamer in a random sequence area, and the aptamer can be combined with the hepatitis delta virus surface antigen in a specific and high-affinity mode or combined with a hepatic cell infected with the hepatitis delta virus in a targeted mode. The RNA aptamer provides a peculiarly efficient labelled molecule for the hepatitis delta diagnosis and treatment field and provides a new choice for developing a hepatitis delta diagnostic reagent and therapeutic drugs.

Description

technical field [0001] The invention belongs to the fields of genetic engineering and biomedicine. The invention relates to a nucleic acid aptamer targeted to infect hepatitis D virus hepatocytes screened by SELEX technology, and the nucleotide sequence of the aptamer. Background technique [0002] Hepatitis D virus HDV infection is one of the important causes of chronic hepatitis, liver cirrhosis and hepatocellular carcinoma. HDV infection is distributed worldwide, but mainly in southern Italy and the Middle East. Its mode of transmission is mainly through blood transfusion or use of blood products, but also through close contact and vertical infection between mother and child. High-risk groups include drug addicts and multiple blood recipients. In recent years, the incidence rate in our country also has a certain growth trend. Therefore, research on the prevention and treatment of hepatitis D has always been an important field of medical and health research in my count...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/115A61K47/26
Inventor 刘红卫
Owner 刘红卫
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com