Cloning and identification of GhDUF231L1 gene related with cotton fiber development
A gene and gene coding technology, applied in genetic engineering, plant genetic improvement, fermentation, etc., can solve the problem that the function of family members needs to be explored.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0027] The present invention is further illustrated by the following drawings and embodiments, but does not limit the scope of the present invention.
[0028] Cloning identification and functional analysis of the full-length sequence of a cotton DUF231 family member GhDUF231L1 gene:
[0029] 1. Isolation and identification of GhDUF231L1 gene sequence and its cDNA sequence
[0030] The cotton genome public database was screened by bioinformatics method, and the GhDUF231L1 gene sequence was analyzed and identified. Cotton genomic DNA was extracted, specific primers GhDUF231L1OE-up (CTTTCTAGAATGAGCTTTGCGGCATCTCCT) and GhDUF231L1OE-dn (CTTCTCGAGCTACAAATGTGCCAAAAATATTC) were designed, and the GhDUF231L1 gene was isolated and cloned by PCR. Cotton fiber RNA 20 days after flowering (20DPA) was extracted, reverse-transcribed into cDNA, and the full-length cDNA sequence of GhDUF231L1 was isolated and cloned by PCR. They were verified by DNA sequencing. The DNA sequence of the GhDUF2...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com