Cloning and identification of GhDUF231L1 gene related with cotton fiber development
A gene and gene coding technology, applied in genetic engineering, plant genetic improvement, fermentation, etc., can solve the problem that the function of family members needs to be explored.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0027] The present invention is further illustrated by the following drawings and embodiments, but does not limit the scope of the present invention.
[0028] Cloning identification and functional analysis of the full-length sequence of a cotton DUF231 family member GhDUF231L1 gene:
[0029] 1. Isolation and identification of GhDUF231L1 gene sequence and its cDNA sequence
[0030] The cotton genome public database was screened by bioinformatics method, and the GhDUF231L1 gene sequence was analyzed and identified. Cotton genomic DNA was extracted, specific primers GhDUF231L1OE-up (CTTTCTAGAATGAGCTTTGCGGCATCTCCT) and GhDUF231L1OE-dn (CTTCTCGAGCTACAAATGTGCCAAAAATATTC) were designed, and the GhDUF231L1 gene was isolated and cloned by PCR. Cotton fiber RNA 20 days after flowering (20DPA) was extracted, reverse-transcribed into cDNA, and the full-length cDNA sequence of GhDUF231L1 was isolated and cloned by PCR. They were verified by DNA sequencing. The DNA sequence of the GhDUF2...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
