Unlock instant, AI-driven research and patent intelligence for your innovation.

Rapid construction method and applications of conditional gene knockout animal model

A construction method and gene knockout technology, applied in the field of gene editing, can solve the problems of high cost, complicated operation, long period of homozygous mice, etc., and achieve economic cost reduction, avoid hybridization process, and shorten the period of gene knockout. Effect

Inactive Publication Date: 2015-07-01
SCI RES TRAINING CENT FOR CHINESE ASTRONAUTS
View PDF1 Cites 54 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this conditional gene knockout method needs to construct two transgenic mice (flox mice and Cre mice) at the same time, and the conditional gene knockout mice can only be obtained by crossing flox mice and Cre mice, Obtaining homozygous mice with conditional gene knockout takes a long period of time, high cost and complicated operation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rapid construction method and applications of conditional gene knockout animal model
  • Rapid construction method and applications of conditional gene knockout animal model
  • Rapid construction method and applications of conditional gene knockout animal model

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Designing gRNA targets for mouse GGCX

[0036] Referring to the gRNA design principles, design gRNA1 and gRNA2 targets for the first and second exons of γ-glutamate carboxylase (GGCX), respectively, and the sequences are as follows:

[0037] gRNA target 1: GAGCAACCAGTGCGGAGCCG (as shown in SEQ ID NO.1)

[0038] gRNA target 2: GCCAGGTTTGCAGGGTCCGT (as shown in SEQ ID NO.2)

[0039] Details such as figure 1 shown.

[0040] Construction of gRNA vector

[0041] 1. Digestion of gRNA empty vector

[0042] The empty gRNA vector was purchased from Addgene. gRNA empty vector ligated in -Blunt II- in the carrier. Digest with Afl II enzyme (NEB), and recover fragment 1 from the gel.

[0043] gRNA empty vector sequence: as shown in SEQ ID NO.3.

[0044] 2. Construction of gRNA target sequence inserts

[0045] 1) Design primer sequences as follows:

[0046] gRNA1 upstream primer gRNA1-F (as shown in SEQ ID NO.4):

[0047] 5'-TTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a rapid construction method of a conditional gene knockout animal model, which is implemented by using a CRISPR / Cas9 technology. The specific method can be implemented as follows: designing a gRNA target spot sequence, for a to-be-knocked-out gene of an animal, of a CRISPR / Cas9 system, designing a corresponding promoter, constructing a plasmid, thereby implementing conditional gene knockout. According to the invention, the rapid, efficient, simple, feasible, economic, efficient, and wide-applicable-scope construction of a conditional gene knockout animal model can be realized, and the defects existing in traditional methods (specific recombination enzyme system Cre-LoxP) can be overcome.

Description

technical field [0001] The invention relates to the technical field of gene editing, in particular to a rapid construction method of a conditional gene knockout animal model and its application. Background technique [0002] CRISPR (clustered regularly interspaced short palindromic repeat sequences) / Cas9 system is a new gene editing technology. This technology uses sgRNA (short guide RNA) with a guiding function to specifically bind to the genomic DNA target sequence, and recruits the Cas9 protein with endonuclease function to cut the target. After the DNA double strand is cut, the stump is repaired by non-homologous end joining when there is no homologous sequence or by homologous recombination when there is homologous sequence. During the repair process, base deletion or addition will occur, resulting in gene inactivation. CRIPSR / Cas9 technology has achieved gene knockout in fruit flies, zebrafish, mice, rats, monkeys, humans and other species, and has been widely used i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/85A01K67/027
Inventor 戴钟铨梁培龙曹宏卿吴峰杨超张洪玉李金桥陈键万玉民李莹辉
Owner SCI RES TRAINING CENT FOR CHINESE ASTRONAUTS
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More