A dna nucleic acid aptamer for detecting grouper iridescent virus infection and its screening method and application

A nucleic acid aptamer and iridescent virus technology, applied in the field of molecular biology, can solve problems such as economic losses, achieve high affinity and specificity, good reproducibility, and facilitate chemical synthesis in vitro

Active Publication Date: 2017-11-21
SOUTH CHINA SEA INST OF OCEANOLOGY - CHINESE ACAD OF SCI
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in recent years, the outbreak and prevalence of iridescent virus in grouper have seriously threatened the mariculture of grouper and caused huge economic losses.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A dna nucleic acid aptamer for detecting grouper iridescent virus infection and its screening method and application
  • A dna nucleic acid aptamer for detecting grouper iridescent virus infection and its screening method and application
  • A dna nucleic acid aptamer for detecting grouper iridescent virus infection and its screening method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] 1. Synthesize the random single-stranded DNA library and primers shown in the following sequence

[0035] Random library Library50:

[0036] 5'-GACGCTTACTCAGGTGTGACTCG(50N)CGAAGGACGCAGATGAAGTCTC

[0037] 5' primer: 5'-FITC-GACGCTTACTCAGGTGTGACTCG-3';

[0038]5' primer: 5'-TAMRA-GACGCTTACTCAGGTGTGACTCG-3';

[0039] 3' primer: 5'-Biotin-GAGACTTCATCTGCGTCCTTCG-3';

[0040] 2. Cell-SELEX screening to obtain nucleic acid aptamers that specifically recognize SGIV-infected GS cells

[0041] 2.1 Add 10% fetal calf serum to the 1L15 medium to cultivate GS cells until 95% of the bottom of the culture bottle is covered, add grouper iridescent virus (SGIV) to the culture bottle, and grouper iridescent virus infects normal grouper splenocytes GS cells, after continuing to culture for 48h, remove the medium in the culture flask of the cells infected by the virus, and wash the infected GS cells with 15ml PBS;

[0042] 2.2 Dissolve 10nmol of the above random library in 300μl bindi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a DNA nucleic acid aptamer for detecting grouper iridescent virus infection, a screening method and application thereof. In each round of screening, two steps of reverse screening were introduced. First, the single-stranded DNA library of the previous round was combined with normal cells to remove non-specific ssDNA combined with normal grouper cells, and then the supernatant was combined with the normal cells. The grouper iridovirus-infected cells were combined for screening, and the ssDNA isolated from the grouper iridovirus-infected cells was then combined with normal cells to obtain the supernatant. PCR amplifies the library to prepare a single-stranded DNA library. Repeat the above screening process, compared with the number of normal cells in the first round of screening, increase the number of normal cells in the screening process by 2-6 times, compared with the binding time of the library and cells in the first round of screening, in the subsequent During the screening process, the binding time between the library and normal cells was increased from 0.5h to 1h, and the binding time between the library and virus-infected cells was shortened from 1h to 0.5h to improve the screening efficiency of each round.

Description

Technical field: [0001] The invention belongs to the field of molecular biology, and in particular relates to a DNA nucleic acid aptamer which can be used for detection of grouper iridescent virus (SGIV) infection at the cell level and tissue level, and a screening method and application thereof. Background technique: [0002] Nucleic acid aptamer is a new type of detection and treatment tool screened by exponential enrichment ligand system evolution (SELEX). Ligand system evolution technology with exponential enrichment is a kind of biological library technology for novel detection and treatment that has attracted wide attention. It uses artificially synthesized, capacity of about 10 14 ~10 15 The random oligonucleotide library is combined with the target substance, and the nucleic acid aptamer of the target substance is obtained after multiple rounds of screening. The nucleic acid aptamers screened by this technology have high specificity and high affinity comparable to...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/115C12N15/10C12Q1/70C12R1/93
Inventor秦启伟李鹏飞魏世娜杨敏周伶俐俞也频
OwnerSOUTH CHINA SEA INST OF OCEANOLOGY - CHINESE ACAD OF SCI