Unlock instant, AI-driven research and patent intelligence for your innovation.

Polydatin bioconversion method using heat-resisting beta-glucosidase and mutants thereof

A technology of glucosidase and mutant, which is applied in the fields of biochemical equipment and methods, glycosylase, enzyme, etc., can solve the problems of low substrate specificity, long conversion time and high cost of enzyme action, and achieve product separation. And the effect of easy purification, short conversion time and few reaction by-products

Inactive Publication Date: 2015-08-05
NANJING NORMAL UNIVERSITY
View PDF7 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although there are many related patent applications, the problems of long conversion time, low substrate specificity, low yield and high cost have not been well solved.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Polydatin bioconversion method using heat-resisting beta-glucosidase and mutants thereof
  • Polydatin bioconversion method using heat-resisting beta-glucosidase and mutants thereof
  • Polydatin bioconversion method using heat-resisting beta-glucosidase and mutants thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0018] Design mutation primers according to the β-glucosidase gene sequence of family 1 of Thermotoga (Thermotiga), specifically:

[0019] N223T-N: AGTTTTCAATACCGGATATTTCGAACCTGCGAGT (SEQ ID NO.4) and N223T-C: ATTCCGATCTTTCCATCTTTCACG (SEQ ID NO.5); select the recombinant plasmid pET-20b-bglA (J Ind Microbiol Biotechnol, 2009,36:1401-1408) was carried out reverse PCR amplification as template to obtain the nucleotide fragment containing β-glucosidase mutant gene, and by phosphorylation, ligation, transformation, and extracting the plasmid, obtained containing The recombinant plasmid of the N223T nucleotide fragment is further transformed into a host to express it, thereby obtaining the β-glucosidase mutant N223T of the present invention.

Embodiment 2

[0021] It is basically the same as Example 1, except that the primers used are: the upstream primer is G224F-N:5'-AGTTTTCAACAACTTCTATTTCGAACCTGCGAGT-3' (SEQ ID NO.6) and the downstream primer is G224F-C:5'-ATTCCGATCTTTCCATCTTTCACG- 3' (SEQ ID NO.7); to obtain a recombinant plasmid containing the G224F nucleotide fragment, and further transform the host to express it, that is, to obtain the β-glucosidase mutant G224F of the present invention.

Embodiment 3

[0023]It is basically the same as Example 1, except that the primers used are: N223T / G224F-N: AGTTTTCAATACCTTTCTATTTCGAACCTGCGAGT (SEQ ID NO.8), the downstream primer is N223T / G224F-C: ATTCCGATCTTTCCATCTTTCACG (SEQ ID NO.9), and A recombinant plasmid containing the N223T / G224F nucleotide fragment is obtained, and the host is further transformed to express it, thereby obtaining the β-glucosidase mutant N223T / G224F of the present invention.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of heat-resisting beta-glucosidase mutants N223T, G224F and N223T / G224F in a conversion of polydatin to resveratrol. According to the heat-resisting beta- glucosidase mutants N223T, G224F and N223T / G224F, the amino acid sequences thereof are represented as SEQ: ID NO. 1, ID NO. 2 and ID NO. 3. By the use of the heat-resisting beta- glucosidase and the mutants thereof to hydrolyze the polydatin for preparing the resveratrol, comparing to the use of wild-type enzymes, the conversion efficiency is high, the reaction byproducts are fewer, the yield and purity are high, the separation and purification are easy, and chemical pollution is less.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a heat-resistant beta-glucosidase mutant N223T, G224F and N223T / G224F, and the application of the enzyme and the mutant in converting polydatin into resveratrol. technical background [0002] Resveratrol is an active polyphenolic substance that has anti-oxidation and anti-free radical effects, and can inhibit various oxidation reactions that cause atherosclerosis and thrombosis. Resveratrol has been listed as an anti-cardiovascular One of the most promising drugs against cancer. Resveratrol mostly exists in veratrum, knotweed and grape skin, and its content is usually low. For example, the content of resveratrol in dried knotweed rhizome is only 0.1%-0.2%, while the content of polydatin is significantly higher than that of resveratrol. Retrol, about 2%. Studies have found that polydatin and arctiin in the form of glycosides do not have the best physiological activity state, and mus...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/42C12P7/22
CPCC12N9/2445C12P7/22C12Y302/01021
Inventor 薛业敏候静静
Owner NANJING NORMAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More