Polydatin bioconversion method using heat-resisting beta-glucosidase and mutants thereof
A technology of glucosidase and mutant, which is applied in the fields of biochemical equipment and methods, glycosylase, enzyme, etc., can solve the problems of low substrate specificity, long conversion time and high cost of enzyme action, and achieve product separation. And the effect of easy purification, short conversion time and few reaction by-products
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0018] Design mutation primers according to the β-glucosidase gene sequence of family 1 of Thermotoga (Thermotiga), specifically:
[0019] N223T-N: AGTTTTCAATACCGGATATTTCGAACCTGCGAGT (SEQ ID NO.4) and N223T-C: ATTCCGATCTTTCCATCTTTCACG (SEQ ID NO.5); select the recombinant plasmid pET-20b-bglA (J Ind Microbiol Biotechnol, 2009,36:1401-1408) was carried out reverse PCR amplification as template to obtain the nucleotide fragment containing β-glucosidase mutant gene, and by phosphorylation, ligation, transformation, and extracting the plasmid, obtained containing The recombinant plasmid of the N223T nucleotide fragment is further transformed into a host to express it, thereby obtaining the β-glucosidase mutant N223T of the present invention.
Embodiment 2
[0021] It is basically the same as Example 1, except that the primers used are: the upstream primer is G224F-N:5'-AGTTTTCAACAACTTCTATTTCGAACCTGCGAGT-3' (SEQ ID NO.6) and the downstream primer is G224F-C:5'-ATTCCGATCTTTCCATCTTTCACG- 3' (SEQ ID NO.7); to obtain a recombinant plasmid containing the G224F nucleotide fragment, and further transform the host to express it, that is, to obtain the β-glucosidase mutant G224F of the present invention.
Embodiment 3
[0023]It is basically the same as Example 1, except that the primers used are: N223T / G224F-N: AGTTTTCAATACCTTTCTATTTCGAACCTGCGAGT (SEQ ID NO.8), the downstream primer is N223T / G224F-C: ATTCCGATCTTTCCATCTTTCACG (SEQ ID NO.9), and A recombinant plasmid containing the N223T / G224F nucleotide fragment is obtained, and the host is further transformed to express it, thereby obtaining the β-glucosidase mutant N223T / G224F of the present invention.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 