Supercharge Your Innovation With Domain-Expert AI Agents!

ub‑nanoluc, ub‑ub‑gs‑nanoluc reporter gene system and its construction and application

A ub-ub-gs-nanoluc and reporter gene technology, which is applied in the application field of flux-based screening of deubiquitinase inhibitors or agonists, can solve the problems of not being able to simulate ubiquitin chains well, false positives, and high costs And other issues

Inactive Publication Date: 2018-02-23
EAST CHINA NORMAL UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In the prior art, currently known methods for high-throughput screening of deubiquitinase activity mainly include Ub-AMC, but since Ub-AMC cannot simulate the formation of ubiquitin chains well, and the AMC reading value stimulates the region Located in the ultraviolet excitation region, it is affected by the excitation absorption spectrum of many small molecules, which will lead to about 20% false positives
Other throughput methods for detecting the activity of deubiquitinating enzymes have disadvantages such as high cost and difficulty in obtaining them. As a new deubiquitinating enzyme that hydrolyzes linear ubiquitinated chains, OTULIN has no ability to hydrolyze Ub-AMC, so So far, no effective high-throughput method for detecting OTULIN activity has been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • ub‑nanoluc, ub‑ub‑gs‑nanoluc reporter gene system and its construction and application
  • ub‑nanoluc, ub‑ub‑gs‑nanoluc reporter gene system and its construction and application
  • ub‑nanoluc, ub‑ub‑gs‑nanoluc reporter gene system and its construction and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0081] Embodiment 1 obtains Ub-Nanoluc reporter gene and protein of the present invention

[0082] Molecular Cloning

[0083] The pET-28a and pCDNA3.1Ub constructed by molecular cloning were preserved by our laboratory, and the PNL1.1 plasmid was obtained from Promega Company.

[0084] Primers for PCR amplification of full-length Ub gene:

[0085] Sense strand: 5'ggatccatgcagatcttcgtgaaaac3' (SEQ ID NO.8); restriction site BamHI

[0086] Antisense strand: 5'ctgcgtctgagaggtggtatggaattc3' (SEQ ID NO.9); restriction site EcoRIPCR amplification full-length Nanoluc gene primer:

[0087] Sense strand: 5'gaattcatggtcttcacactcgaagatt3' (SEQ ID NO.10); enzyme cutting site EcoRI

[0088] Antisense strand: 5'gtgcgaacgcattctggcgtactcgag3' (SEQ ID NO.11); restriction site XhoIPCR reaction system

[0089]

[0090] PCR reaction conditions

[0091]

[0092] After the PCR reaction is completed, use the Tiangen Gel Recovery Kit to recover the PCR fragments

[0093] Digest with Takara ...

Embodiment 2

[0163] Embodiment 2 constructs polyclonal antibody

[0164] Construction of prokaryotic Nanoluc expression clones and purification of GST-Nanoluc protein (refer to Example 1 for experimental methods)

[0165] Polyclonal Antibody Preparation

[0166] Immune animals: two New Zealand rabbits

[0167] Adjuvant: Complete Freund's adjuvant was used first, followed by incomplete Freund's adjuvant.

[0168] Immunogen: GST-Nanoluc. 500 μg of immunogen per immunization.

[0169]Immunization: Dilute the immunogen with phosphate buffer, and then mix it with the corresponding adjuvant 1:1. The antigen and adjuvant are completely mixed to form a stable emulsion. The emulsion is injected subcutaneously under the skin around the shoulders of the rabbit and intramuscularly injected into the hind thigh , about 1 / 4 of the immunogen is used in each area, so that the immunogen can persist and improve the immune response.

[0170] Blood collection: Use a 19-gauge needle to collect blood from t...

Embodiment 3

[0180] Example 3 Deubiquitinating enzyme USP15 hydrolyzes the isopeptide tendon between ubiquitin and Nanoluc luciferase and detects protein levels by Western Blot

[0181] (1) The deubiquitinating enzyme USP15 hydrolyzes the isopeptide tendon between ubiquitin and Nanoluc luciferase:

[0182] Incubate the deubiquitinating enzyme USP15 protein and Ub-Nanoluc protein molecules in the reaction system at 30°C for half an hour

[0183] (2) Detection of protein level by Western Blot:

[0184] The basic principle of Western Blot is antigen-antibody reaction. Proteins were separated by polyacrylamide gel electrophoresis and transferred to a solid support (nitrocellulose membrane was used in this experiment). React with a specific primary antibody, and then react with a fluorescent secondary antibody to develop color, and the immunoblot image of the specific protein molecule can be obtained. This method has the characteristic of detecting specific antigens from mixed antigens.

[...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses an Ub-Nanoluc reporter gene system and an Ub-Ub-GS-Nanoluc reporter gene system, and applications of the Ub-Nanoluc reporter gene system and the Ub-Ub-GS-Nanoluc reporter gene system in deubiquitination enzyme activity detection and deubiquitination enzyme inhibitor throughput-screening, wherein the Ub-Nanoluc reporter gene DNA sequence is represented by SEQ ID NO.1, and the Ub-Ub-GS-Nanoluc reporter gene DNA sequence is represented by SEQ ID NO.4. According to the present invention, the high sensitivity characteristic of luciferase Nanoluc is utilized to provide the method for deubiquitination enzyme activity detection and deubiquitination enzyme inhibitor throughput-screening by using the chemical luminescent reporter gene so as to provide the new action target point and the new ideal for screening and research of new drugs including anticancer drugs, and provide broad application prospects, great enormous benefits, and great social benefits.

Description

technical field [0001] The present invention relates to the field of biotechnology, in particular to a new Ub-Nanoluc reporter gene system and Ub-Ub-GS-Nanoluc reporter gene system, and its application in the detection of deubiquitinating enzyme activity. Use of ubiquitinase inhibitors or agonists. Background technique [0002] The ubiquitin-proteasome pathway is an important regulatory system for protein degradation in cells. Through polyubiquitination of substrate proteins and degradation by proteasomes, it can affect or regulate a variety of cellular activities, including: gene transcription, cell cycle, immune response, cell ligand receptor function, tumor growth, inflammation, etc. . [0003] Deubiquitinases are a large family of proteases, which specifically remove ubiquitin molecules from the ubiquitin-linked The protein or precursor protein of the protein is hydrolyzed. Deubiquitinating enzymes can be divided into five categories: (1) Ubiquitin carboxyl-terminal ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/47C12N9/02C12N15/62C12N15/10C12Q1/66C12Q1/37
CPCC07K14/47C07K2319/61C12Q1/37C12Q1/66
Inventor 陈云飞王路凡程晓牧王平
Owner EAST CHINA NORMAL UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More