Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

PCR method and kit for synchronously identifying animal-derived ingredients

An animal-derived component, sheep technology, applied in the field of animal-derived component identification, can solve the problem of low specificity of multiple PCR technology that can only identify one species at a time, achieve good specificity and sensitivity, improve efficiency, The effect of improving detection efficiency

Active Publication Date: 2015-10-07
CHINA JILIANG UNIV +1
View PDF3 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] In order to solve the problem that only one species can be identified at a time in the existing species identification technology, and the multiple PCR technology has low specificity, the present invention provides a method that can identify goats, sheep, buffaloes, cattle, and pigs in one PCR operation. , deer, camel and yak 8 kinds of animal-derived components, and the species identification detection kit obtained therefrom

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • PCR method and kit for synchronously identifying animal-derived ingredients
  • PCR method and kit for synchronously identifying animal-derived ingredients
  • PCR method and kit for synchronously identifying animal-derived ingredients

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1 Primer Design

[0027] According to the gene sequence published by GenBank, the mtDNA of goat (GU229278), deer (HQ191428), buffalo (AF702618), cattle (EU177861), sheep (KF938337), yak (KM233416), pig (AF486867) and camel (AP003423) The whole sequence was used as a template, and the mtDNA sequences of 8 species and common species (chicken, duck, rabbit, mouse, horse, dog) were compared and analyzed. According to the specificity and conservation of their gene sequences, Primer premier 5.0 software was used to design A universal primer for multiple species, the primer is paired with the mtDNA sequences of the above-mentioned 8 species of goat, sheep, buffalo, domestic cattle, pig, deer, camel and yak. The primer sequences are as follows:

[0028] Universal downstream primer (SEQ ID NO: 1): AGCGGGTTGCTGGTTTCACG,

[0029] Universal upstream primer (SEQ ID NO: 2): CCTCCCTAAGACTCAAGGAA.

Embodiment 2

[0030] The optimization of embodiment 2 PCR reaction system

[0031] The PCR reaction system uses 20 μL of the basic system, including 2.0 μL of Buffer buffer, 0.2 μL of SEQ ID 1 and SEQ ID 2, 1.6 μL of dNTP mix, and 1.6 μL of MgCl 2 Buffer, 3.0 μL genomic DNA extraction solution (about 30ng DNA), 0.2 μL Taq DNA polymerase, and finally add water to make up to 20 μL.

[0032] According to the above PCR system, a temperature gradient was set on the gradient PCR instrument to optimize the annealing temperature (temperature range 45.0-65.0° C.). The basic PCR process is as follows: denaturation at 95°C for 5 min; denaturation at 95°C for 40 s, different annealing temperatures for 30 s, and extension at 72°C for 40 s as a cycle, a total of 30 cycles; then extension at 72°C for 10 min.

[0033]The PCR products at different temperatures were detected by electrophoresis (4S Red agarose nucleic acid dye), and the temperature with the best electrophoresis results was selected as the te...

Embodiment 3

[0036] Example 3 Enzyme digestion identification of PCR products

[0037] In order to better distinguish the 8 species in the present invention, especially goats and sheep, buffaloes, yaks and domestic cattle with similar PCR product sizes, the inventors compared the amplified sequences and used biological software to find suitable internal Finally, SspI endonuclease was selected to digest and identify PCR products. The results showed that after digestion, PCR products of different species produced fragments of different sizes. Goat PCR products were divided into four fragments of 291bp, 192bp, 160bp and 118bp; sheep The PCR product was divided into 300bp, 213bp and three 75bp fragments after enzyme digestion; the deer PCR product was digested to produce two fragments of 391bp and 146bp; the buffalo and camel PCR products had no cutting point, so the original size of 486bp and 359bp were retained respectively; The bovine PCR product has two fragments of 303bp and 178bp after d...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of tracing and identifying of meat and animal-derived related products and particularly provides a PCR method and kit for synchronously identifying animal-derived ingredients, including a primer and method capable of identifying 8 animal-derived ingredients of goat, sheep, deer, buffalo, domestic cattle, yak, pig and camel at the same time in a PCR reaction as well as a kit containing the primer and an application method. The nucleotide sequence of the primer is shown by SEQ ID 1 and SEQ ID 2. The method provided by the invention is simple to operate, has high specificity, imposes low requirements on equipment and can be used for identifying 8 animal-derived ingredients at the same time in a PCR reaction. The technology provided by the invention is applicable to the adulteration detection and trace identification of meat and products thereof, the method is simple and fast, the screening range of unknown species is expanded, and the detection efficiency is improved.

Description

technical field [0001] The invention relates to the technical field of inspection of animal-derived components in meat and animal products, in particular to a PCR method for identifying components derived from goats, sheep, buffaloes, cattle, pigs, deer, camels and yaks using mitochondrial DNA and Reagent test kit. Background technique [0002] The identification of animal-derived ingredients originates from the detection of cattle and sheep ingredients added to animal feed. "Mad Cow Disease" occurred in the UK in 1985 and spread to many European countries and regions in the following years. "Mad Cow Disease" not only brought economic losses to these countries, but also brought political crises. Later studies proved that the ingredients of cattle and sheep origin containing "mad cow disease" pathogenic factor prion protein added to the feed is an important medium for spreading the disease. detection. Nowadays, with the development of social economy, meat and its products...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6888
Inventor 管峰薛超波顾佳瑛王萍亚黄朱梁林昕罗媛媛
Owner CHINA JILIANG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com