LAMP detection method of utilizing mitochondrial DNA to identify cat meat in beef and mutton
A detection method, the technology of beef and mutton, is applied in the field of molecular biology detection, which can solve the problems of difficult popularization and application and long time-consuming, and achieve the effect of broad market prospect, simple operation and high specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] Embodiment 1 Designs primers
[0033] The COXI sequence of the cat was retrieved from GenBank, and software comparison analysis was performed to confirm the accuracy of the sequence; according to the above sequence, primers were designed using PrimerExplore software as follows:
[0034] MF3: CACTTCCTAGGCCTGTCC (as shown in SEQ ID NO.1),
[0035] MB3: ATGTGTGGTACGGAGGAG (as shown in SEQ ID NO.2),
[0036] MFIP:GAAAGAGCCCATTGAGGAAATCGTAGACGTTATTCTGACTATCCAGAT (shown in SEQ ID NO.3),
[0037] MBIP: GTTTTCATAGTGTGAGAAGCTTTCGCAAGATTAGTTGTGGTTAGTTCT (shown in SEQ ID NO. 4).
Embodiment 2
[0038] Embodiment 2 specificity experiment
[0039] (1) Extract DNA as a template
[0040] The fresh muscle tissues of cattle, sheep, dogs, cats, foxes and minks were strictly aseptically collected as samples, and then the DNA in the tissues were extracted by phenol-chloroform extraction method. The positive plasmid (positive control), ultrapure water (negative control), dog meat DNA, cat meat DNA, mink meat DNA, fox meat DNA, beef DNA and mutton DNA stored in our laboratory were respectively used as templates A LAMP reaction system was established; the DNA template concentration was 20ng / uL.
[0041] (2) Establishment of LAMP reaction system
[0042] The LAMP reaction system established by exploring the concentration ratio of internal and external primers, dNTP concentration, reaction temperature, and reaction time is 25 μL, and its composition is as follows:
[0043] 10umol / L MF3, MB3 0.5uL each, 10umol / L MFIP, MBIP 4uL each, 2.5mmol / L dNTP4uL, 50mmol / L MgSO 4 2uL, 2.5uL...
Embodiment 3
[0048] Collect 30 fresh beef samples and 30 fresh mutton samples from the slaughterhouse in Shandong Province; collect 10 fresh cat meat samples from Shandong Provincial Animal Hospital; use the method of Example 1 to extract the DNA of the samples as a template, establish a LAMP reaction system, and carry out LAMP amplification reaction, detection results are shown in Table 1:
[0049] Table 1
[0050]
beef mutton cat meat beef and lamb beef and cat meat lamb and cat Number of samples 30 30 10 30 10 10 number of positives 0 0 10 0 10 10 Positive ratio / % 0 0 100 0 100 100
[0051] It can be concluded from Examples 2 and 3 that the primers in Example 1 can specifically amplify cat meat DNA, and only when the template contains cat meat DNA, the reaction solution after adding the fluorescent dye SYBRGREEN I to the LAMP reaction product shows green; and Templates containing any other non-cat meat (cow, sheep, mink, fox,...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com