cDNA of chalcone isomerase that controls anthocyanin synthesis in Cymbidium japonica

A technology of chalcone isomerase and snow orchid, applied in the field of cDNA, can solve the problem of lack of freshness of monocotyledons

Inactive Publication Date: 2018-05-25
NORTHEAST NORMAL UNIVERSITY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the research on chalcone isomerase is mostly concentrated on dicotyledonous plants, and there are few reports on monocotyledonous plants, especially the monocotyledonous horticultural flower plant Fragrant Snowberry has not been reported.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • cDNA of chalcone isomerase that controls anthocyanin synthesis in Cymbidium japonica
  • cDNA of chalcone isomerase that controls anthocyanin synthesis in Cymbidium japonica
  • cDNA of chalcone isomerase that controls anthocyanin synthesis in Cymbidium japonica

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1 wxya Cloning of full-length genes

[0034] wxya Acquisition of full-length gene sequence: Design specific upstream and downstream primers based on known transcriptome sequencing results. Use the Trizol kit to extract the total RNA of the petals of Cymbidium safflower, and reverse transcribe to generate the first strand of cDNA, which is used as a template for RT-PCR to obtain wxya The full-length sequence of the gene, the results are as follows Figure 1 .

[0035] The specific primers and specific PCR reaction conditions for cloning the full-length cDNA are as follows:

[0036] Primers CHIF1: TCTAATGACAACAACAACGC CHIR1: TTCTTACGACGTGATCCTTT

[0037] PCR conditions: pre-denaturation at 94°C for 10min; denaturation at 94°C for 30s; annealing at 56°C for 30s;

[0038] Extension at 72°C for 1min; final extension at 72°C for 10min; denaturation to extension for a total of 30 cycles.

[0039] Primer CHIF2: TTCTGATGACAATGGTGGAG CHIR2: TTTCTCCTCTGCCTTCCATA ...

Embodiment 2

[0045] Example 2 Homology Comparison Analysis

[0046] Express the protein sequence of FhCHIs and the protein sequence of alfalfa MsaCHI1 in FASTA format, save it as a TXT file, and then input it into ClustalW2 online software for homology comparison of their amino acids, and you can observe their most homologous amino acid positions; Put the protein sequence into the DNAMAN software according to the comparison results, and the identical amino acids are displayed with a dark blue background. Observe the four active sites of MsaCHI1, arginine (Arg36), threonine (Thr48), tyrosine (Tyr106 ), asparagine (Asn113), whether FhCHI1, FhCHI2, and FhCHI5 also have these amino acids.

Embodiment 3

[0047] Example 3 wxya Semi-quantitative expression analysis in different periods and its correlation with anthocyanin content

[0048] The RNAs of five different stages of safflower, pandan snow flower, green bud, red and green, red bud, first bloom, and full bloom were extracted respectively, and the total cDNA was obtained after inversion. Then, using it as a template, the primers of the three genes were used for semi-analysis. Quantitative RT-PCR was used to analyze the expression level. Using SPSS software, the gene expression level and the anthocyanin accumulation content in these five periods were correlated with each other.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention clones three chalcone isomerase (CHI) cDNAs for the first time from the petals of safflower safflower, and determines its nucleotide sequence and the resulting amino acid sequence. During the flower coloring process of Cymbidium thaliana, the expression of the three genes and the synthesis of anthocyanins showed an obvious correlation. In addition, the three eukaryotic expression vectors of FhCHI were transfected into the CHI mutant of Arabidopsis thaliana, and the seedlings and seed coats of the three FhCHI mutants were both The phenotype was restored.

Description

technical field [0001] The invention belongs to the technical field of plant molecular biology, and in particular relates to isolating three cDNAs encoding chalcone isomerase (FhCHI) from petals of safflower safflower. Background technique [0002] Chalcone isomerase (chalcone isomerase, CHI) is one of the key enzymes in the early stage of the flavonoid synthesis pathway, and it is an essential enzyme for the biosynthesis of plant anthocyanins. Under the catalysis of CHI, naringenin chalcone forms yellow Alkanones and flavanones are converted into flavonoid compounds of various colors under the catalysis of other enzymes, thereby forming different flower colors. [0003] Evolutionary analysis revealed that CHI is a stereospecific enzyme that evolved from fatty acid binding proteins. The CHI superfamily contains four types of proteins. Type Ⅰ is commonly found in vascular plants and is responsible for the synthesis of flavonoids; type Ⅱ is involved in the synthesis of isofl...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/61C12N9/90
Inventor王丽梁瓴婕高翔
OwnerNORTHEAST NORMAL UNIVERSITY