Primer for preparing shRNA, preparing method, vector and building method
A technology of carrier and expression vector, which is applied in the field of preparation of shRNA primers and preparation, can solve the problems of cumbersome operation, low cloning efficiency, and too long primer design, and achieve the effect of simple and fast operation, cheap reagents, and no need for sequencing identification
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0081] Example 1: Construction of shRNA lentiviral interference vector containing ccdB
[0082] (1) Preparation of vector backbone pLVX-EF1a-copGFP-Puro:
[0083] Using the pCDF1-MCS2-EF1-copGFP (SBI company) vector as a template, the EF1a-copGFP fragment was amplified by PCR (see Table 1 for the primer sequence), and the PCR product was double-digested with MluI and AfeI, and then inserted into the same MluI and AfeI On the double-digested lentiviral vector pLVX-Puro (Clontech Company), the vector backbone pLVX-EF1a-copGFP-PGK-Puro was obtained.
[0084] (2) Insert the shRNA expression promoter:
[0085] The vector pLVX-EF1a-copGFP-PGK-Puro obtained in step (1) was digested with ClaI and XhoI, recovered by electrophoresis after dephosphorylation; after the PCR product of the hU6 promoter was amplified by double digestion with ClaI and XhoI (for primer sequences, see Table 2), connected to the corresponding site of the pLVX-EF1a-copGFP-Puro vector, transformed into Escherich...
Embodiment 2
[0088] Embodiment 2: Utilize the three primer annealing method of the present invention to prepare the shRNA of gene HSPA9, REDD1 and SRC
[0089] In this embodiment, three primers were firstly designed respectively for the siRNA sequences of the target genes HSPA9, REDD1 and SRC (see Table 4, SEQ NO.12-23). Among them, the siRNA sequence of HSPA9 is CGTGCTCAATTTGAAGGGATT (SEQNO.9), the siRNA sequence of REDD1 is TGATGCCTAGCCAGTTGGTAA (SEQNO.10), the siRNA sequence of SRC is GACAGACCTGTCCTTCAAGAA (SEQNO.11), and then design a group of irrelevant sequences as the shRNA of the above genes Silencing effect control (shcontrol).
[0090] Table 4 is used for the oligonucleotide primers of three primers annealing synthetic shRNA
[0091] Primer name
[0092] After designing and synthesizing shRNA primers according to the design scheme of the above-mentioned three-primer annealing method, add the three oligonucleotide primers of the target gene according to the system in Ta...
Embodiment 3
[0096] Example 3: Construction of shRNA lentiviral interference vectors for genes HSPA9, REDD1 and SRC
[0097] The shRNA lentiviral interference vector pLVX-U6-ccdB-EF1a-copGFP-PGK-Puro was single-digested with BsmBI to obtain a 9.0kb pLVX-U6-EF1a-copGFP-PGK-Puro vector backbone, which was synthesized by annealing in Example 2 shHSPA9, shREDD1 and shSRC were respectively connected to the pLVX-U6-EF1a-copGFP-PGK-Puro vector backbone through the corresponding restriction sites, and then transformed into E. Take a single clone for sequencing, and the sequencing results are as follows: Figure 3-5 As shown, the shRNA lentiviral interference vectors pLVX-U6-shHSPA9-EF1a-copGFP-PGK-Puro, pLVX-U6-shREDD1-EF1a-copGFP-PGK-Puro and pLVX-U6- shSRC-EF1a-copGFP-PGK-Puro. At the same time, using shcontrol as a negative control, construct pLVX-U6-shcontrol-EF1a-copGFP-PGK-Puro.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 