Unlock instant, AI-driven research and patent intelligence for your innovation.

Primer for preparing shRNA, preparing method, vector and building method

A technology of carrier and expression vector, which is applied in the field of preparation of shRNA primers and preparation, can solve the problems of cumbersome operation, low cloning efficiency, and too long primer design, and achieve the effect of simple and fast operation, cheap reagents, and no need for sequencing identification

Active Publication Date: 2015-12-09
SHENZHEN UNIV
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0009] In view of the above-mentioned deficiencies in the prior art, the object of the present invention is to provide a primer and a preparation method, a carrier and a construction method for preparing shRNA. The shRNA preparation method provided by the present invention can be fast, efficient, low-cost, and high-throughput. Preparation of high-fidelity shRNA is especially suitable for large-scale construction of animal and plant RNA interference (RNAinterference, RNAi) expression vectors for functional research on animal and plant genes, aiming to solve the problems of excessively long primer design, low cloning efficiency, and manipulation in the prior art. cumbersome and other issues

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer for preparing shRNA, preparing method, vector and building method
  • Primer for preparing shRNA, preparing method, vector and building method
  • Primer for preparing shRNA, preparing method, vector and building method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0081] Example 1: Construction of shRNA lentiviral interference vector containing ccdB

[0082] (1) Preparation of vector backbone pLVX-EF1a-copGFP-Puro:

[0083] Using the pCDF1-MCS2-EF1-copGFP (SBI company) vector as a template, the EF1a-copGFP fragment was amplified by PCR (see Table 1 for the primer sequence), and the PCR product was double-digested with MluI and AfeI, and then inserted into the same MluI and AfeI On the double-digested lentiviral vector pLVX-Puro (Clontech Company), the vector backbone pLVX-EF1a-copGFP-PGK-Puro was obtained.

[0084] (2) Insert the shRNA expression promoter:

[0085] The vector pLVX-EF1a-copGFP-PGK-Puro obtained in step (1) was digested with ClaI and XhoI, recovered by electrophoresis after dephosphorylation; after the PCR product of the hU6 promoter was amplified by double digestion with ClaI and XhoI (for primer sequences, see Table 2), connected to the corresponding site of the pLVX-EF1a-copGFP-Puro vector, transformed into Escherich...

Embodiment 2

[0088] Embodiment 2: Utilize the three primer annealing method of the present invention to prepare the shRNA of gene HSPA9, REDD1 and SRC

[0089] In this embodiment, three primers were firstly designed respectively for the siRNA sequences of the target genes HSPA9, REDD1 and SRC (see Table 4, SEQ NO.12-23). Among them, the siRNA sequence of HSPA9 is CGTGCTCAATTTGAAGGGATT (SEQNO.9), the siRNA sequence of REDD1 is TGATGCCTAGCCAGTTGGTAA (SEQNO.10), the siRNA sequence of SRC is GACAGACCTGTCCTTCAAGAA (SEQNO.11), and then design a group of irrelevant sequences as the shRNA of the above genes Silencing effect control (shcontrol).

[0090] Table 4 is used for the oligonucleotide primers of three primers annealing synthetic shRNA

[0091] Primer name

[0092] After designing and synthesizing shRNA primers according to the design scheme of the above-mentioned three-primer annealing method, add the three oligonucleotide primers of the target gene according to the system in Ta...

Embodiment 3

[0096] Example 3: Construction of shRNA lentiviral interference vectors for genes HSPA9, REDD1 and SRC

[0097] The shRNA lentiviral interference vector pLVX-U6-ccdB-EF1a-copGFP-PGK-Puro was single-digested with BsmBI to obtain a 9.0kb pLVX-U6-EF1a-copGFP-PGK-Puro vector backbone, which was synthesized by annealing in Example 2 shHSPA9, shREDD1 and shSRC were respectively connected to the pLVX-U6-EF1a-copGFP-PGK-Puro vector backbone through the corresponding restriction sites, and then transformed into E. Take a single clone for sequencing, and the sequencing results are as follows: Figure 3-5 As shown, the shRNA lentiviral interference vectors pLVX-U6-shHSPA9-EF1a-copGFP-PGK-Puro, pLVX-U6-shREDD1-EF1a-copGFP-PGK-Puro and pLVX-U6- shSRC-EF1a-copGFP-PGK-Puro. At the same time, using shcontrol as a negative control, construct pLVX-U6-shcontrol-EF1a-copGFP-PGK-Puro.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer for preparing shRNA (short hairpin RNA), a preparing method, a vector and a building method. The primer for preparing shRNA comprises primers P1, P2 and P3, wherein the length of the P1 is 34nt; from the 5' end, the P1 sequentially comprises a projected cohesive end ACCG, an 21nt siRNA (small interfering RNA) positive sequence, a loop sequence and a basic group in reverse complementation with three basic groups at the 3' tail end of the siRNA positive sequence; four basic groups at the 5' end of the P2 are changed into AAAA by ACCG, and the other sequence is identical to that of the P1; and the P3 is the reverse complementary sequence of the 18nt sequence at the 5' tail end of the siRNA positive sequence. The length of each of the three primers does not exceed 35nt; the basic group error occurring the long-primer synthesis process can be effectively avoided; the fidelity of the shRNA is improved; the cost is low; and the primer is applicable to high-flux preparation of the shRNA.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a primer for preparing shRNA, a preparation method, a carrier and a construction method. Background technique [0002] RNA interference (RNAi) is a gene silencing mechanism that is ubiquitous in organisms, has strong sequence specificity, and is post-transcriptional. At present, the rapid realization of gene silencing in vivo by using RNAi technology has become a powerful experimental tool in the study of gene function in animals and plants. [0003] Due to the characteristics of animals and plants and the differences in their mechanisms of RNAi, the molecules of RNAi used in the study of gene functions in animals and plants are also different. At present, the commonly used small RNA molecules that play an interfering role in animals mainly include siRNA (small interfering RNA), shRNA (shorthairpin RNA) and amiRNA (artificial microRNA). In plants, there are mainly hpRNA (hairpinRNA...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/11C12N15/113C12N15/10C12N15/867C12N15/66
Inventor 苟德明康康李洁璇黄炼
Owner SHENZHEN UNIV