Pseudovirions and preparation method and application thereof

A technology of pseudovirion and influenza A virus, which is applied in the field of pseudovirion and its preparation, can solve the problems of natural virus infection risk, RNA molecule instability, difficulty in meeting test requirements, etc., and achieve strong practical value and good stability Effect

Inactive Publication Date: 2015-12-30
GUANGDONG HECIN SCI INC
View PDF4 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Due to the potential risk of infection of natural viruses and the instability of RNA molecules, currently used quality controls such as inactivated virus particles, cDNA, plasmid DNA, naked RNA, and in vitro transcribed RNA are difficult to meet the test requirements, so The development of stable, non-biologically infectious quality control products is of great significance not only for the RT-PCR detection of RNA viruses, but also for the evaluation of commercial virus RT-PCR kits

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pseudovirions and preparation method and application thereof
  • Pseudovirions and preparation method and application thereof
  • Pseudovirions and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] The present embodiment contains the preparation method of the pseudovirion of three kinds of detection fragments of influenza A virus, influenza B virus and β-actin in series, and its specific preparation steps are:

[0050] (1), construction of recombinant plasmid pSE380-MS2:

[0051] 1. According to the MS2 phage gene sequence (NC_001417) in the GenBank database, primers for PCR amplification of the envelope protein gene, maturation enzyme gene, and packaging signal sequence of MS2 bacteriophage were independently designed and artificially synthesized; the primers were: MS2L:CCTTTCGGGGTCCTGCTC (SEQ ID NO: 1) MS2BglIIR:GATTAGATCTGAGTTGAACTTCTTTGTTGTCTTC (SEQ ID NO: 2).

[0052] 2. Apply the above primers, use the MS2 phage gene as a template, and perform RT-PCR amplification according to conventional techniques to obtain a product of about 1780 bp, including the envelope protein gene, maturation enzyme gene, and packaging signal sequence of MS2 phage.

[0053] 3. Comb...

Embodiment 2

[0076] Example 2: Homogeneity Test of Virus-Like Particles as Strong Positive Control and Borderline Positive Control

[0077] Take 10 strong positive controls and 10 critical positive controls stored at -20°C, shake, mix and centrifuge, and take 50uL each for fluorescent PCR detection. The amplification system, amplification program, primers and probes are as follows.

[0078] RT-PCR amplification system:

[0079] 5×RT-PCRbuffer (final concentration)

dNTP (final concentration)

0.6mM

[0080] Primer (used amount)

10pmol

Probe (Usage)

3pmol

Taq (consumption)

1U

MMLV (consumption)

50U

DEPC water

Make up to 20μl

(template)

(5μl)

[0081] The RT-PCR reaction procedure is as follows:

[0082]

[0083] Primers and probes are as follows:

[0084]

[0085] The Ct value of the fluorescent PCR result was used for statistical analysis to evaluate the uniformity of the str...

Embodiment 3

[0097] Example 3: Stability analysis of virus-like particles as strong positive control and critical positive control

[0098] Three tubes of the strong positive control and critical positive control stored at -20°C were taken at different time points for fluorescent PCR assay. For the detection method and the primers and probes used, see Example 2. The stability of each storage condition was statistically analyzed. Samples were taken once in the first month, and once a month from the sixth month onwards, and the fluorescent PCR assay and statistical analysis were performed. attached image 3It is the result graph of the stability test in October. The results of the 10 stability test data are shown in the following table:

[0099]

[0100] Strong positive control substance detects the regression analysis of variance of CT value (IA):

[0101]

[0102]

[0103] Strong positive control substance detects the regression analysis of variance of CT value (IB):

[0104]...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses pseudovirions; a capsid protein of MS2 bacteriophage is wrapped with a DNA-protein complex of a detection sequence formed by series connection of three base fragments of influenza A virus, influenza B virus and beta-actin successively. The invention also provides a preparation method of the pseudovirions and an application of the pseudovirions as quality control products for detecting the influenza A virus and the hepatitis B virus. The preparation method of the pseudovirions is simple and is easy to operate; the obtained pseudovirus is high in purity, can be used as the quality control products in an influenza A virus and influenza B virus nucleic acid detection kit, and has the characteristics of no infectivity, good stability, ribonuclease resistance and the like.

Description

technical field [0001] The invention belongs to the technical field of in vitro diagnosis of pathogens, and in particular relates to a pseudovirus particle and a preparation method and application thereof. Background technique [0002] With the rapid development of molecular biology technology, various molecular biology diagnostic techniques based on polymerase chain reaction, because of their strong specificity, high sensitivity, good repeatability, accurate quantification, convenient and fast, etc. The most valuable research tool in the field of biomedicine has been widely used in the detection of clinical specimens. In the detection of RNA virus RT-PCR, the random error in the operation of the experimenter, the temperature difference between the wells of the amplification instrument, the residue of the inhibitor after the nucleic acid extraction of the sample, the concentration of the target nucleic acid to be amplified, the efficiency of reverse transcription and reagent...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N7/04C12N15/63C12Q1/70C12Q1/68
Inventor李小锋李晨阳崔红商兴芳
OwnerGUANGDONG HECIN SCI INC