Method for preparing rebaudioside M according to saccharomyces cerevisiae enzymatic method

A technology of Saccharomyces cerevisiae and recombinant Saccharomyces cerevisiae, which is applied in the field of preparing rebaudioside M by using Saccharomyces cerevisiae enzymatic method, which can solve the safety problems of rebaudioside M, save fermentation time and steps, reduce costs, and have good safety Effect

Inactive Publication Date: 2015-12-30
PEPSICO INC
View PDF5 Cites 17 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The technical problem to be solved by the present invention is to overcome the safety problem of rebaudioside M produced by the engineered bacteria itself in the process of preparing rebaudioside M by Escherichia coli containing UDP-glucosyltransferase in the prior art , to provide a method for the preparation of rebaudioside M through the enzymatic method of generally recognized safe strains, which can produce high-purity rebaudioside M products at a lower cost and in a shorter cycle

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for preparing rebaudioside M according to saccharomyces cerevisiae enzymatic method
  • Method for preparing rebaudioside M according to saccharomyces cerevisiae enzymatic method
  • Method for preparing rebaudioside M according to saccharomyces cerevisiae enzymatic method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] Example 1 Preparation of recombinant S. cerevisiae cells containing UGT-A

[0047]According to the pYES2 plasmid sequence, primers pYES2-AgeI-F (GATGATCCACTAGTAACCGGTAGAAGCCGCCG) and pYES2-AgeI-R (CGGCGGCTTCTACCGGTTACTAGTGGATCATC) were designed, and the AgeI cutting site was introduced into the pYES2 plasmid by circular expansion PCR to obtain the plasmid pYES2-AgeI.

[0048] Using the INVSc2 genome as a template, primers ADH2-F (CACTAGTAACCGGTGCAAAACGTAGGGGC) and ADH2-R (GTCCAGCCCAAGCTTGTATTACGATATAG) were designed, the ADH2 promoter gene fragment was amplified by PCR, and the gel was cut and recovered. The obtained gene fragment was digested with AgeI / HindIII, the purified fragment was recovered, and T4 ligase was added to connect the fragment into the corresponding restriction site of pYES2-AgeI to obtain the pEZADH2 plasmid.

[0049] According to the nucleotide sequence shown in SEQIDNO.2 in the sequence listing, the UGT-A gene fragment was gene-synthesized and conn...

Embodiment 2

[0051] Embodiment 2 prepares UGT-A freeze-dried powder

[0052] The recombinant cells of UGT-A prepared in Example 1 were ultrasonically disrupted in an ice bath, the disrupted solution was centrifuged (8,000 rpm, 10 min), and the supernatant was collected and freeze-dried for 24 hours to obtain a freeze-dried powder of UGT-A.

Embodiment 3

[0053] Example 3 Preparation of recombinant Saccharomyces cerevisiae permeable cells containing UGT-A

[0054] Method 1: Weigh 1g of wet thallus of the recombinant cells of UGT-A prepared in Example 1, resuspend to 20ml75mmol imidazole-0.1mol / LKCl-10mmol / LMgCl2+1ml toluene: dehydrated alcohol (v / v)= 1:4, 25°C, shaken at 160rpm for 15min, centrifuged to collect cells (4,000rpm, 10min), concentrated 10 times and resuspended in 0.1mol / L phosphate buffer (pH7.0) to obtain UGT-A recombinant Saccharomyces cerevisiae Sex cells are used for catalysis.

[0055] Method 2: Pick a single colony from the plate and place it in SC-Ura+2% glucose medium, culture at 30°C with 200rpm shaking for 48h, inoculate EZ-A bacteria into 50ml YPD+1%glucose medium at 30°C, at a ratio of 2%. After shaking at 200rpm for 48h, add 500ul of 20% TritonX-100 (V / V), continue shaking for 2h, collect cells by centrifugation (4,000rpm, 10min), and resuspend with 5ml of 0.1mol / L phosphate buffer (pH7.0) cells, rec...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for preparing rebaudioside M according to a saccharomyces cerevisiae enzymatic method. The method for preparing rebaudioside M comprises the following steps: utilizing recombinant saccharomyces cerevisiae containing UDP-glucosyltransferase or UDP-glucosyltransferase prepared from the recombinant saccharomyces cerevisiae to catalyze rebaudioside A or rebaudioside D in the presence of a glucosyl group donor, so as to generate rebaudioside M. The recombinant saccharomyces cerevisiae is obtained by introducing a strong promoter into a plasmid to obtain a vector plasmid, inserting a UDP-glucosyltransferase gene into the vector plasmid through a restriction site to obtain an expression vector under the control the strong promoter, and carrying out saccharomyces cerevisiae transformation. The method for preparing rebaudioside M has the advantages that the high-safety recombinant saccharomyces cerevisiae is utilized for catalytic production; the produced UDP-glucosyltransferase is higher in expression level and activity; the produced rebaudioside M can be directly utilized as a food additive, and is short in production period, higher in yield, and relatively low in cost.

Description

technical field [0001] The invention belongs to the field of bioengineering enzyme production, and in particular relates to a method for preparing rebaudioside M by utilizing Saccharomyces cerevisiae enzymatically. Background technique [0002] Sweeteners are a class of food additives widely used in the production of food, beverages and confectionery. They can be added during the production of food, or can be used as a substitute for sucrose after proper dilution during home baking. Sweeteners include natural sweeteners such as sucrose, high fructose corn syrup, honey, etc., and artificial sweeteners such as aspartame and saccharin. Stevioside is a kind of natural sweetener extracted from plant stevia, which has been widely used in food and beverages. The stevia extract contains a variety of steviosides including rebaudioside. Naturally extracted steviosides vary greatly in different batches and require subsequent purification. The current commercialized product rebaudiosi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12P19/56C12R1/865
CPCC12N9/1051C12N9/1062C12P19/56C12Y204/01017C12R2001/865C12N1/185
Inventor杜好勉魏喜换谢新开陶军华托马斯·李
OwnerPEPSICO INC