Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for expression of CRISPR sgRNA by eukaryotic cell III-type promoter and use thereof

A technology of promoter and RNA interference, applied in DNA/RNA fragments, recombinant DNA technology, introduction of foreign genetic material using vectors, etc., can solve problems such as unreported, and achieve the effect of simple structure and convenient construction

Inactive Publication Date: 2016-01-20
NORTHWEST A & F UNIV
View PDF2 Cites 44 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, similar methods have not been reported in animals

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for expression of CRISPR sgRNA by eukaryotic cell III-type promoter and use thereof
  • Method for expression of CRISPR sgRNA by eukaryotic cell III-type promoter and use thereof
  • Method for expression of CRISPR sgRNA by eukaryotic cell III-type promoter and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1 Target site selection

[0024] Based on the characteristics of the target sites of the CRISPR / Cas9 system, the target sites containing PAM (NGG / NGGNG) were searched in the genome. After screening on the CRISPRDesign website (http: / / crispr.mit.edu / ), the following two sites were selected as target sites:

[0025] VEGF Target Site Fragment:

[0026] CTCGGCCACCACAGGGAAGCTGG (SEQ ID NO: 1)

[0027] CCR5a / CCR2 target site fragment:

[0028]CACACTTGTCACCACCCCAAAGGTG (SEQ ID NO: 2)

Embodiment 2Ca

[0029] Example 2 Cas9 protein expression vector

[0030] The optimized Streptococcus pyogenes Cas9 sequence (hSpCas9) was inserted into the backbone vector pll3.7. like figure 2 shown. The sequence of hSpCas9 is as follows (SEQ ID NO: 3):

[0031] GACAAGAAGTACAGCATCGGCCTGGACATCGGCACCAACTCTGTGGGCTGGGCCGTGATC

[0032] ACCGACGAGTACAAGGTGCCCAGCAAGAAATTCAAGGTGCTGGGCAACACCGACCGGCAC

[0033] AGCATCAAGAAGAACCTGATCGGAGCCCTGCTGTTCGACAGCGGCGAAACAGCCGAGGCC

[0034] ACCCGGCTGAAGAGAACCGCCAGAAGAAGATACACCAGACGGAAGAACCGGATCTGCTAT

[0035] CTGCAAGAGATCTTCAGCAACGAGATGGCCAAGGTGGACGACAGCTTCTTCCACAGACTG

[0036] GAAGAGTCCTTCCTGGTGGAAGAGGATAAGAAGCACGAGCGGCACCCCATCTTCGGCAAC

[0037] ATCGTGGACGAGGTGGCCTACCACGAGAAGTACCCCACCATCTACCACCTGAGAAAGAAA

[0038] CTGGTGGACAGCACCGACAAGGCCGACCTGCGGCTGATCTATCTGGCCCTGGCCCACATG

[0039] ATCAAGTTCCGGGGCCACTTCCTGATCGAGGGCGACCTGAACCCCCGACAACAGCGACGTG

[0040] GACAAGCTGTTCATCCAGCTGGTGCAGACCTACAACCAGCTGTTCGAGGAAAACCCCATC

[0041] AACGCCAGCGGCGTGGACGCCAAGGCCATC...

Embodiment 3

[0100] Example 3 Multiple small RNA expression vectors (msgRNA-2) connected in series

[0101] Taking the experimental carrier as an example, the carrier is designed as a U6-sgRNA-shRNA-sgRNA structure. According to the selected two target sites (VEGF target site and CCR5a target site), the corresponding sgRNA sequences are respectively designed, with CD40 shRNA sequences of Drosha target sites. The individual fragments are joined together by cutting sites of different restriction endonucleases. The sequences of the two Drosha target sites used in this experiment are as follows:

[0102] Drosha target site fragment 1: TCCGAGGCAGTAGGCA (SEQ ID NO: 4)

[0103] Drosha target site fragment 2: TGCTGTTGACAGTGAGCG (SEQ ID NO: 5)

[0104] Construction of this vector requires two steps. In the first step, the gene fragments of the three RNA sequences were inserted between the multiple cloning sites NheI and ApaI on the backbone vector pcDNA3.1(+) (Invitrogen), and each fragment was...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for expression of CRISPR sgRNA by a eukaryotic cell III-type promoter and a use thereof. A eukaryotic cell III-type promoter (U6 or H1) starts expression of multiple hairpin structure small RNAs connected in series by Drosha cleavage sites. Through expression in the eukaryotic cell, multiple CRISPR sgRNAs with bioactivity can be produced. Aiming at the U6-sgRNA-shRNA-shRNA structure, the U6-started expression structure can produce a primary transcript containing multiple sgRNAs and shRNAs. In the eukaryotic cell, through processing, the sgRNAs can respectively identify corresponding target sites so that the Cas9 protein is guided to target multiple sites and thus a foundation is laid for multiple gene editing. Compared with the traditional method for expression multiple sgRNAs and the tRNA-gRNA system new reported by Plants, the method provided by the invention has a simple structure and is convenient for construction. Through a Golden Gate method, shRNA-sgRNA sequences are connected in series so that more sites are targeted or multiple shRNA interference genes are expressed.

Description

technical field [0001] The application relates to gene promoter expression technology and belongs to the field of biotechnology. Background technique [0002] Drosha: a type III ribonuclease that localizes and cleaves mRNAs by recognizing their secondary stem-loop structure similar to miRNAs precursors, which plays an important role in the mechanism of repressing gene expression in stem cells. [0003] In vivo, the maturation of miRNA is more complex than the formation of siRNA double strands. It can be summarized as follows: firstly, the precursor of miRNA, pri-miRNA, is processed by an enzyme called Drosha in the nucleus to become a 70nt stem-loop structure. Precursor miRNAs (pre-miRNAs) (Denlie et al., 2004; Gregory et al., 2004; Han et al., 2004); these pre-miRNAs are transported outside the nucleus with the help of Exportin-5 and then processed by the cytoplasmic Dicer enzyme. Become mature miRNAs (Lundetal., 2004; Yietal., 2003). [0004] CRISPR: clustered regularly ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/79C12N15/85C12N15/11
Inventor 张智英闫强徐坤邢佳妮郭杨任充华
Owner NORTHWEST A & F UNIV