Method for synthesizing nucleotide pools in high-throughput manner by aid of semiconductor chips and assembling double-stranded DNA (deoxyribonucleic acid)

A nucleotide pool and semiconductor technology, applied in the field of molecular biology, can solve the problems of cumbersome steps, high cost, low degree of integration and miniaturization, etc., and achieve the effect of high throughput and low cost

Inactive Publication Date: 2016-01-27
SUZHOU HONGXUN BIOTECH CO LTD
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] The method commonly used in the current technology is to synthesize nucleotides on a chip and then assemble double-stranded DNA using this as a raw material. The steps of gene synthesis and error repair are cumbersome, the degree of integration and miniaturization is low, and the cost is high. Therefore, a method is now needed Combining semiconductor chip synthesis technology and DNA large fragment assembly technology together, using electrochemical semiconductor chip and DNA large fragment assembly technology to successfully develop a next-generation DNA synthesis platform

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for synthesizing nucleotide pools in high-throughput manner by aid of semiconductor chips and assembling double-stranded DNA (deoxyribonucleic acid)
  • Method for synthesizing nucleotide pools in high-throughput manner by aid of semiconductor chips and assembling double-stranded DNA (deoxyribonucleic acid)
  • Method for synthesizing nucleotide pools in high-throughput manner by aid of semiconductor chips and assembling double-stranded DNA (deoxyribonucleic acid)

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] like figure 1 As shown, a kind of semiconductor chip high-throughput synthetic nucleotide pool and a method for assembling double-stranded DNA are disclosed in Embodiment 1. The method steps are:

[0040] (1) Segment the pre-synthesized double-stranded DNA into multiple 200-1000bp DNA fragments.

[0041] (2) Design nucleotides with the DNA fragment in (1), the length of each nucleotide is 30-90nt.

[0042](3) Add 20nt flank sequences to both ends of the 30-90nt nucleotides designed in (2), use TypeII or TypeIIs restriction endonuclease to recognize and digest the sequence, and synthesize a total length of 80-200nt Nucleotide sequence, wherein the nucleotides are prepared by a semiconductor chip; in this embodiment, the above-mentioned TypeII or TypeIIs restriction endonuclease is used for the high-throughput synthesis of nucleotide pools on the semiconductor chip, and the TypeII restriction endonuclease Enzymes include, but are not limited to: EcoRI, BamhI, HindIII; t...

Embodiment 2

[0049] Example 2 discloses an example of actually synthesizing double-stranded DNA by the method in Example 1.

[0050] The sequence of pre-synthesized DNA being divided into DNA fragments (414bp) in embodiment 2 is as follows:

[0051] GGATCCAGAGCAGAGGAGCCAGCTGTGGGCACCAGTGGCCTCATCTTCCGAGAAGACTTGGACTGGCCTCCAGGCAGCCCACAAGAGCCTCTGTGCCTGGTGGCACTGGGCGGGGACAGCAATGGCAGCAGCTCCCCCCTGCGGGTGGTGGGGGCTCTAAGCGCCTATGAGCAGGCCTTCCTGGGGGCCGTGCAGAGGGCCCGCTGGGGCCCCCGAGACCTGGCCACCTTCGGGGTCTGCAACACCGGTGACAGGCAGGCTGCCTTGCCCTCTCTACGGCGGCTGGGGGCCTGGCTGCGGGACCCTGGGGGGCAGCGCCTGGTGGTCCTACACCTGGAGGAAGTGACCTGGGAGCCAACACCCTCGCTGAGGTTCCAGGAGCCCCCGCCTGGAGGAGCTGGCCCCCCACTCGAG

[0052] Step 1: Primers designed according to the DNA sequence are shown in Table 1:

[0053] Table 1 Design primer list

[0054]

[0055]

[0056] Step 2: Add a 20nt flank sequence and an enzyme recognition site sequence to both ends of the above-mentioned designed primers. In this embodiment, the TypeIIs restriction endonucleas...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for synthesizing nucleotide pools in a high-throughput manner by the aid of semiconductor chips and assembling double-stranded DNA (deoxyribonucleic acid). The method includes steps of (1), dividing pre-synthetic double-stranded DNA into a plurality of DNA fragments; (2), designing nucleotide by the aid of the DNA fragments; (3), adding sequences to two ends of a primer which is the nucleotide, synthesizing nucleotide sequences and preparing the nucleotide sequences by the aid of the semiconductor chips; (4), carrying out first-round amplification by the aid of the primer with biotin labels; (5), recombining first-round PCR (polymerase chain reaction) products by the aid of at least one type of recombinant enzymes; (6), purifying PCR mixtures; (7), carrying out second-round PCR, and assembling nucleotide fragments to obtain assembled PCR products; (8), carrying out third-round PCR amplification on the PCR products by the aid of designed head and tail primers to obtain double-stranded DNA fragments. The method has the advantages of low cost and high one-step synthesis throughput.

Description

technical field [0001] The invention belongs to the field of molecular biology, in particular to the technical field of DNA synthesis, and specifically relates to a high-throughput method for synthesizing nucleotide pools and assembling double-stranded DNA on semiconductor chips. Background technique [0002] Synthetic biology is an emerging interdisciplinary subject in the 21st century. It uses engineering research ideas to design and modify genes, biological components, biological pathways, and even the entire genome. It is used in the fields of biology, medicine, environmental protection, energy, and agriculture. It has broad application prospects. Synthetic biology technology mainly includes: synthesis of double-stranded DNA, synthesis of regulatory elements, operon synthesis, gene synthesis, etc. Among them, gene synthesis is the main component of synthetic biology and the basis and skeleton of synthetic biology. Gene synthesis refers to the technology of artificially ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/10
Inventor刁文一齐金才柳伟强孙德斌杨平
OwnerSUZHOU HONGXUN BIOTECH CO LTD