Method for synthesizing nucleotide pools in high-throughput manner by aid of semiconductor chips and assembling double-stranded DNA (deoxyribonucleic acid)
A nucleotide pool and semiconductor technology, applied in the field of molecular biology, can solve the problems of cumbersome steps, high cost, low degree of integration and miniaturization, etc., and achieve the effect of high throughput and low cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] like figure 1 As shown, a kind of semiconductor chip high-throughput synthetic nucleotide pool and a method for assembling double-stranded DNA are disclosed in Embodiment 1. The method steps are:
[0040] (1) Segment the pre-synthesized double-stranded DNA into multiple 200-1000bp DNA fragments.
[0041] (2) Design nucleotides with the DNA fragment in (1), the length of each nucleotide is 30-90nt.
[0042](3) Add 20nt flank sequences to both ends of the 30-90nt nucleotides designed in (2), use TypeII or TypeIIs restriction endonuclease to recognize and digest the sequence, and synthesize a total length of 80-200nt Nucleotide sequence, wherein the nucleotides are prepared by a semiconductor chip; in this embodiment, the above-mentioned TypeII or TypeIIs restriction endonuclease is used for the high-throughput synthesis of nucleotide pools on the semiconductor chip, and the TypeII restriction endonuclease Enzymes include, but are not limited to: EcoRI, BamhI, HindIII; t...
Embodiment 2
[0049] Example 2 discloses an example of actually synthesizing double-stranded DNA by the method in Example 1.
[0050] The sequence of pre-synthesized DNA being divided into DNA fragments (414bp) in embodiment 2 is as follows:
[0051] GGATCCAGAGCAGAGGAGCCAGCTGTGGGCACCAGTGGCCTCATCTTCCGAGAAGACTTGGACTGGCCTCCAGGCAGCCCACAAGAGCCTCTGTGCCTGGTGGCACTGGGCGGGGACAGCAATGGCAGCAGCTCCCCCCTGCGGGTGGTGGGGGCTCTAAGCGCCTATGAGCAGGCCTTCCTGGGGGCCGTGCAGAGGGCCCGCTGGGGCCCCCGAGACCTGGCCACCTTCGGGGTCTGCAACACCGGTGACAGGCAGGCTGCCTTGCCCTCTCTACGGCGGCTGGGGGCCTGGCTGCGGGACCCTGGGGGGCAGCGCCTGGTGGTCCTACACCTGGAGGAAGTGACCTGGGAGCCAACACCCTCGCTGAGGTTCCAGGAGCCCCCGCCTGGAGGAGCTGGCCCCCCACTCGAG
[0052] Step 1: Primers designed according to the DNA sequence are shown in Table 1:
[0053] Table 1 Design primer list
[0054]
[0055]
[0056] Step 2: Add a 20nt flank sequence and an enzyme recognition site sequence to both ends of the above-mentioned designed primers. In this embodiment, the TypeIIs restriction endonucleas...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com