HRM method for detecting genetic polymorphism of CYP3A4*1G and MDR1C1236T

A technology of MDR1C1236T and gene polymorphism, applied in the field of biotechnology and medicine, can solve the problems of long detection cycle, unsuitable for large sample detection, heavy workload, etc.

Inactive Publication Date: 2016-01-27
AFFILIATED HUSN HOSPITAL OF FUDAN UNIV
View PDF1 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The RFLP method combines PCR with restriction enzyme digestion, because of its cumbersome experimental operations, long detection cycle, incomplete first round of enzyme digestion leading to false positive results, and can only be used for the judgment of known SNPs, there is no restriction site It is only suitable for the detection of a small number of samples due to factors such as the inability to detect
The denaturing gradient electrophoresis method has a commercial electrophoresis device, which is suitable for the detection and screening of large samples, but because the method uses temperature and gradient gel mobility for detection, gel electrophoresis is required, and the secondary structure of the DNA chain is likely to cause artificial false phases , leading to biased results
In the DNA direct sequencing method, the PCR products are sequenced after electrophoresis on a fully automatic sequencer. The method is advanced, but the workload is heavy, the time is long, and the price is expensive. It is not suitable for the detection of large samples.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • HRM method for detecting genetic polymorphism of CYP3A4*1G and MDR1C1236T
  • HRM method for detecting genetic polymorphism of CYP3A4*1G and MDR1C1236T
  • HRM method for detecting genetic polymorphism of CYP3A4*1G and MDR1C1236T

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0106] Example 1 Screening of CYP3A4*1G primers

[0107] Taking the CYP3A4*1G gene as an example, PrimerPremier software was used for primer design.

[0108] Sequence of CYP3A4*1G gene:

[0109] (SEQ ID NO11)

[0110] GGCTATGAAACCACGAGCAGTGTTTCTCCTTCATTATGTATGAACTGGCCACTCACCCTGATGTCCAGCAGAAACTGCAGGAGGAAATTGATGCAGTTTTACCCAATAAGGTGAGTGGATG R TACATGGAGAAGGAGGGAGGAGGTGAAACCTTAGCAAAAATGCCTCCTCACCACTTCCCAGGAGAA

[0111] ( R Indicates the gene mutation site)

[0112] The size of the primer fragment will affect the specificity of PCR amplification as follows:

[0113]

[0114] Therefore, with reference to the above-mentioned effects, the primer fragments with a size of 18-23 bp were selected for design, and the primers were synthesized by Shanghai Sangon Biotechnology Co., Ltd. The primers were verified by agarose gel electrophoresis, and the preferred forward and reverse primers were obtained, as shown in the above table. figure 1 It is the electrophoresis graph obtained by...

Embodiment 2

[0115] Determination of the PCR reaction system of embodiment 2CYP3A4*1G

[0116] The PCR reaction includes PCR buffer, dNTPs, Mgcl 2 , DNA polymerase, primers, template DNA and fluorescent dye, the PCR reaction system is (total volume is 20 μ L):

[0117]

Embodiment 3

[0118] The determination of the HRM condition of embodiment 3CYP3A4*1G

[0119] The optimization of the HRM conditions is mainly optimized and adjusted in terms of the initial temperature of the melting temperature and the number of times the fluorescence is monitored per second.

[0120] Optimal conditions:

[0121]

[0122] The PCR and HRM reaction conditions are:

[0123]

[0124] image 3 It is a high-resolution melting curve diagram of the CYP3A4*1G locus control genotype of the embodiment of the present invention;

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of molecular biology and medicine, and discloses an HRM analysis technology for detecting genetic polymorphism of CYP3A4*1G and MDR1C1236T. The method includes the following steps: (1) searching DNA sequences of target genes; (2) designing and screening appropriate primer pairs aiming at mutation loci of the target genes; (3) extracting sample DNA, and carrying out gene amplification by using the primers screened in the step (2); (4) analyzing whether a PCR product is obtained through specific amplification by an agarose gel electrophoresis method; and (5) according to a high-resolution dissolution curve method, detecting the mutation loci of the amplified target genes, and selecting an SYTO-9 saturated fluorescent dye. A sequence specific probe is not needed during testing, sequencing is not needed, the test is not limited by mutation base loci and types, genetic information is simply and quickly provided for clinical individualized medication, and a help is provided for rational drug use and clinical drug monitoring.

Description

technical field [0001] The invention relates to the fields of biotechnology and medicine, and relates to gene detection related to pharmacokinetics. In particular, it relates to an HRM method for detecting gene polymorphisms of CYP3A4*1G and MDR1C1236T. The method of the present invention can complete rapid detection of a large number of samples at one time, and the method is simple, accurate, reliable, time-saving and labor-saving, and provides convenience for clinical individualized rational drug use. Background technique [0002] High Resolution Melting Analysis Technology (High Resolution Melting), referred to as HRM, is a tool for SNP and mutation research jointly developed by the University of Utah and Edward Technology Corporation. It can detect 84% of human SNPs (single nucleotide polymorphisms). ). Based on the different physical properties of nucleic acid molecules affecting the melting temperature, HRM detects the combination of saturated fluorescent dyes and PC...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/68
Inventor李中东张在丽马春来施孝金钟明康
OwnerAFFILIATED HUSN HOSPITAL OF FUDAN UNIV